ID: 926743240

View in Genome Browser
Species Human (GRCh38)
Location 2:16129374-16129396
Sequence AGGACTTCATCAGTTGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926743236_926743240 14 Left 926743236 2:16129337-16129359 CCACATCTATGGTCTTGTCTCTT No data
Right 926743240 2:16129374-16129396 AGGACTTCATCAGTTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926743240 Original CRISPR AGGACTTCATCAGTTGTCCC TGG Intergenic
No off target data available for this crispr