ID: 926747055

View in Genome Browser
Species Human (GRCh38)
Location 2:16167520-16167542
Sequence CCAAGCACTGCTGGGTGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926747050_926747055 16 Left 926747050 2:16167481-16167503 CCTCATCCAGTATCTTAGAGACT No data
Right 926747055 2:16167520-16167542 CCAAGCACTGCTGGGTGACGAGG No data
926747051_926747055 10 Left 926747051 2:16167487-16167509 CCAGTATCTTAGAGACTGAGCAT No data
Right 926747055 2:16167520-16167542 CCAAGCACTGCTGGGTGACGAGG No data
926747048_926747055 24 Left 926747048 2:16167473-16167495 CCATATTCCCTCATCCAGTATCT No data
Right 926747055 2:16167520-16167542 CCAAGCACTGCTGGGTGACGAGG No data
926747049_926747055 17 Left 926747049 2:16167480-16167502 CCCTCATCCAGTATCTTAGAGAC No data
Right 926747055 2:16167520-16167542 CCAAGCACTGCTGGGTGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926747055 Original CRISPR CCAAGCACTGCTGGGTGACG AGG Intergenic
No off target data available for this crispr