ID: 926749753

View in Genome Browser
Species Human (GRCh38)
Location 2:16189336-16189358
Sequence CATGCTGCTCCTTCTGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926749753_926749763 27 Left 926749753 2:16189336-16189358 CCCCAGGCAGAAGGAGCAGCATG No data
Right 926749763 2:16189386-16189408 AGGTGGCTCCTGGTGACTGGTGG No data
926749753_926749759 7 Left 926749753 2:16189336-16189358 CCCCAGGCAGAAGGAGCAGCATG No data
Right 926749759 2:16189366-16189388 GATGAGGGACATGTGTGTTCAGG No data
926749753_926749761 17 Left 926749753 2:16189336-16189358 CCCCAGGCAGAAGGAGCAGCATG No data
Right 926749761 2:16189376-16189398 ATGTGTGTTCAGGTGGCTCCTGG No data
926749753_926749762 24 Left 926749753 2:16189336-16189358 CCCCAGGCAGAAGGAGCAGCATG No data
Right 926749762 2:16189383-16189405 TTCAGGTGGCTCCTGGTGACTGG No data
926749753_926749764 30 Left 926749753 2:16189336-16189358 CCCCAGGCAGAAGGAGCAGCATG No data
Right 926749764 2:16189389-16189411 TGGCTCCTGGTGACTGGTGGCGG No data
926749753_926749757 -9 Left 926749753 2:16189336-16189358 CCCCAGGCAGAAGGAGCAGCATG No data
Right 926749757 2:16189350-16189372 AGCAGCATGTACAGGAGATGAGG No data
926749753_926749758 -8 Left 926749753 2:16189336-16189358 CCCCAGGCAGAAGGAGCAGCATG No data
Right 926749758 2:16189351-16189373 GCAGCATGTACAGGAGATGAGGG No data
926749753_926749760 10 Left 926749753 2:16189336-16189358 CCCCAGGCAGAAGGAGCAGCATG No data
Right 926749760 2:16189369-16189391 GAGGGACATGTGTGTTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926749753 Original CRISPR CATGCTGCTCCTTCTGCCTG GGG (reversed) Intergenic
No off target data available for this crispr