ID: 926753639

View in Genome Browser
Species Human (GRCh38)
Location 2:16219281-16219303
Sequence GGGGAGGAACAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926753639_926753660 23 Left 926753639 2:16219281-16219303 CCCTCCTCCTTCTGTTCCTCCCC No data
Right 926753660 2:16219327-16219349 CATTGTTATTACTAAATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926753639 Original CRISPR GGGGAGGAACAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr