ID: 926756999

View in Genome Browser
Species Human (GRCh38)
Location 2:16244417-16244439
Sequence GGAGCAGACACAGATTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926756999_926757001 -6 Left 926756999 2:16244417-16244439 CCTGAGAAATCTGTGTCTGCTCC No data
Right 926757001 2:16244434-16244456 TGCTCCTGCCAGTGACTCATGGG No data
926756999_926757000 -7 Left 926756999 2:16244417-16244439 CCTGAGAAATCTGTGTCTGCTCC No data
Right 926757000 2:16244433-16244455 CTGCTCCTGCCAGTGACTCATGG No data
926756999_926757009 29 Left 926756999 2:16244417-16244439 CCTGAGAAATCTGTGTCTGCTCC No data
Right 926757009 2:16244469-16244491 CTACCATGAATGAGACCTGCTGG No data
926756999_926757002 -5 Left 926756999 2:16244417-16244439 CCTGAGAAATCTGTGTCTGCTCC No data
Right 926757002 2:16244435-16244457 GCTCCTGCCAGTGACTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926756999 Original CRISPR GGAGCAGACACAGATTTCTC AGG (reversed) Intergenic
No off target data available for this crispr