ID: 926757003

View in Genome Browser
Species Human (GRCh38)
Location 2:16244438-16244460
Sequence AGGCCCCATGAGTCACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926757003_926757009 8 Left 926757003 2:16244438-16244460 CCTGCCAGTGACTCATGGGGCCT No data
Right 926757009 2:16244469-16244491 CTACCATGAATGAGACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926757003 Original CRISPR AGGCCCCATGAGTCACTGGC AGG (reversed) Intergenic
No off target data available for this crispr