ID: 926757004

View in Genome Browser
Species Human (GRCh38)
Location 2:16244442-16244464
Sequence GGTGAGGCCCCATGAGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926757004_926757009 4 Left 926757004 2:16244442-16244464 CCAGTGACTCATGGGGCCTCACC No data
Right 926757009 2:16244469-16244491 CTACCATGAATGAGACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926757004 Original CRISPR GGTGAGGCCCCATGAGTCAC TGG (reversed) Intergenic
No off target data available for this crispr