ID: 926757009

View in Genome Browser
Species Human (GRCh38)
Location 2:16244469-16244491
Sequence CTACCATGAATGAGACCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926756999_926757009 29 Left 926756999 2:16244417-16244439 CCTGAGAAATCTGTGTCTGCTCC No data
Right 926757009 2:16244469-16244491 CTACCATGAATGAGACCTGCTGG No data
926757003_926757009 8 Left 926757003 2:16244438-16244460 CCTGCCAGTGACTCATGGGGCCT No data
Right 926757009 2:16244469-16244491 CTACCATGAATGAGACCTGCTGG No data
926757004_926757009 4 Left 926757004 2:16244442-16244464 CCAGTGACTCATGGGGCCTCACC No data
Right 926757009 2:16244469-16244491 CTACCATGAATGAGACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926757009 Original CRISPR CTACCATGAATGAGACCTGC TGG Intergenic
No off target data available for this crispr