ID: 926758184

View in Genome Browser
Species Human (GRCh38)
Location 2:16252597-16252619
Sequence TCAGAGAAATGAGAACTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926758184_926758191 27 Left 926758184 2:16252597-16252619 CCAAATAGTTCTCATTTCTCTGA No data
Right 926758191 2:16252647-16252669 ATTCCTGTACTAACATGGTGGGG No data
926758184_926758190 26 Left 926758184 2:16252597-16252619 CCAAATAGTTCTCATTTCTCTGA No data
Right 926758190 2:16252646-16252668 GATTCCTGTACTAACATGGTGGG No data
926758184_926758189 25 Left 926758184 2:16252597-16252619 CCAAATAGTTCTCATTTCTCTGA No data
Right 926758189 2:16252645-16252667 AGATTCCTGTACTAACATGGTGG No data
926758184_926758192 28 Left 926758184 2:16252597-16252619 CCAAATAGTTCTCATTTCTCTGA No data
Right 926758192 2:16252648-16252670 TTCCTGTACTAACATGGTGGGGG No data
926758184_926758188 22 Left 926758184 2:16252597-16252619 CCAAATAGTTCTCATTTCTCTGA No data
Right 926758188 2:16252642-16252664 TGAAGATTCCTGTACTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926758184 Original CRISPR TCAGAGAAATGAGAACTATT TGG (reversed) Intergenic
No off target data available for this crispr