ID: 926758185

View in Genome Browser
Species Human (GRCh38)
Location 2:16252624-16252646
Sequence CTTCAGAGAGTAAAGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926758185_926758191 0 Left 926758185 2:16252624-16252646 CCTCTGCCCTTTACTCTCTGAAG No data
Right 926758191 2:16252647-16252669 ATTCCTGTACTAACATGGTGGGG No data
926758185_926758194 21 Left 926758185 2:16252624-16252646 CCTCTGCCCTTTACTCTCTGAAG No data
Right 926758194 2:16252668-16252690 GGGATCCTGAGATAAATATGTGG No data
926758185_926758190 -1 Left 926758185 2:16252624-16252646 CCTCTGCCCTTTACTCTCTGAAG No data
Right 926758190 2:16252646-16252668 GATTCCTGTACTAACATGGTGGG No data
926758185_926758189 -2 Left 926758185 2:16252624-16252646 CCTCTGCCCTTTACTCTCTGAAG No data
Right 926758189 2:16252645-16252667 AGATTCCTGTACTAACATGGTGG No data
926758185_926758192 1 Left 926758185 2:16252624-16252646 CCTCTGCCCTTTACTCTCTGAAG No data
Right 926758192 2:16252648-16252670 TTCCTGTACTAACATGGTGGGGG No data
926758185_926758188 -5 Left 926758185 2:16252624-16252646 CCTCTGCCCTTTACTCTCTGAAG No data
Right 926758188 2:16252642-16252664 TGAAGATTCCTGTACTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926758185 Original CRISPR CTTCAGAGAGTAAAGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr