ID: 926758188

View in Genome Browser
Species Human (GRCh38)
Location 2:16252642-16252664
Sequence TGAAGATTCCTGTACTAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926758184_926758188 22 Left 926758184 2:16252597-16252619 CCAAATAGTTCTCATTTCTCTGA No data
Right 926758188 2:16252642-16252664 TGAAGATTCCTGTACTAACATGG No data
926758183_926758188 23 Left 926758183 2:16252596-16252618 CCCAAATAGTTCTCATTTCTCTG No data
Right 926758188 2:16252642-16252664 TGAAGATTCCTGTACTAACATGG No data
926758185_926758188 -5 Left 926758185 2:16252624-16252646 CCTCTGCCCTTTACTCTCTGAAG No data
Right 926758188 2:16252642-16252664 TGAAGATTCCTGTACTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926758188 Original CRISPR TGAAGATTCCTGTACTAACA TGG Intergenic
No off target data available for this crispr