ID: 926760560

View in Genome Browser
Species Human (GRCh38)
Location 2:16275248-16275270
Sequence CAGGGGAATTTTGTGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926760560_926760570 8 Left 926760560 2:16275248-16275270 CCGTCCTCCACAAAATTCCCCTG No data
Right 926760570 2:16275279-16275301 AGCTGAAGACAACTCTGTAAGGG No data
926760560_926760571 11 Left 926760560 2:16275248-16275270 CCGTCCTCCACAAAATTCCCCTG No data
Right 926760571 2:16275282-16275304 TGAAGACAACTCTGTAAGGGTGG No data
926760560_926760569 7 Left 926760560 2:16275248-16275270 CCGTCCTCCACAAAATTCCCCTG No data
Right 926760569 2:16275278-16275300 CAGCTGAAGACAACTCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926760560 Original CRISPR CAGGGGAATTTTGTGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr