ID: 926761420

View in Genome Browser
Species Human (GRCh38)
Location 2:16282090-16282112
Sequence CCTAGTTTCTGGAGGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926761420_926761426 9 Left 926761420 2:16282090-16282112 CCTCTCTTCCTCCAGAAACTAGG No data
Right 926761426 2:16282122-16282144 GATGACCAGGCACAGACACCTGG No data
926761420_926761429 16 Left 926761420 2:16282090-16282112 CCTCTCTTCCTCCAGAAACTAGG No data
Right 926761429 2:16282129-16282151 AGGCACAGACACCTGGCTGTGGG No data
926761420_926761424 -4 Left 926761420 2:16282090-16282112 CCTCTCTTCCTCCAGAAACTAGG No data
Right 926761424 2:16282109-16282131 TAGGCTGAAAACCGATGACCAGG No data
926761420_926761428 15 Left 926761420 2:16282090-16282112 CCTCTCTTCCTCCAGAAACTAGG No data
Right 926761428 2:16282128-16282150 CAGGCACAGACACCTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926761420 Original CRISPR CCTAGTTTCTGGAGGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr