ID: 926761422

View in Genome Browser
Species Human (GRCh38)
Location 2:16282098-16282120
Sequence GTTTTCAGCCTAGTTTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926761422_926761429 8 Left 926761422 2:16282098-16282120 CCTCCAGAAACTAGGCTGAAAAC No data
Right 926761429 2:16282129-16282151 AGGCACAGACACCTGGCTGTGGG No data
926761422_926761426 1 Left 926761422 2:16282098-16282120 CCTCCAGAAACTAGGCTGAAAAC No data
Right 926761426 2:16282122-16282144 GATGACCAGGCACAGACACCTGG No data
926761422_926761428 7 Left 926761422 2:16282098-16282120 CCTCCAGAAACTAGGCTGAAAAC No data
Right 926761428 2:16282128-16282150 CAGGCACAGACACCTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926761422 Original CRISPR GTTTTCAGCCTAGTTTCTGG AGG (reversed) Intergenic
No off target data available for this crispr