ID: 926761423

View in Genome Browser
Species Human (GRCh38)
Location 2:16282101-16282123
Sequence TCGGTTTTCAGCCTAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926761423_926761428 4 Left 926761423 2:16282101-16282123 CCAGAAACTAGGCTGAAAACCGA No data
Right 926761428 2:16282128-16282150 CAGGCACAGACACCTGGCTGTGG No data
926761423_926761431 29 Left 926761423 2:16282101-16282123 CCAGAAACTAGGCTGAAAACCGA No data
Right 926761431 2:16282153-16282175 ATCTCTCTGCAGAGCTCACCTGG No data
926761423_926761426 -2 Left 926761423 2:16282101-16282123 CCAGAAACTAGGCTGAAAACCGA No data
Right 926761426 2:16282122-16282144 GATGACCAGGCACAGACACCTGG No data
926761423_926761432 30 Left 926761423 2:16282101-16282123 CCAGAAACTAGGCTGAAAACCGA No data
Right 926761432 2:16282154-16282176 TCTCTCTGCAGAGCTCACCTGGG No data
926761423_926761429 5 Left 926761423 2:16282101-16282123 CCAGAAACTAGGCTGAAAACCGA No data
Right 926761429 2:16282129-16282151 AGGCACAGACACCTGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926761423 Original CRISPR TCGGTTTTCAGCCTAGTTTC TGG (reversed) Intergenic
No off target data available for this crispr