ID: 926761428

View in Genome Browser
Species Human (GRCh38)
Location 2:16282128-16282150
Sequence CAGGCACAGACACCTGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926761423_926761428 4 Left 926761423 2:16282101-16282123 CCAGAAACTAGGCTGAAAACCGA No data
Right 926761428 2:16282128-16282150 CAGGCACAGACACCTGGCTGTGG No data
926761420_926761428 15 Left 926761420 2:16282090-16282112 CCTCTCTTCCTCCAGAAACTAGG No data
Right 926761428 2:16282128-16282150 CAGGCACAGACACCTGGCTGTGG No data
926761422_926761428 7 Left 926761422 2:16282098-16282120 CCTCCAGAAACTAGGCTGAAAAC No data
Right 926761428 2:16282128-16282150 CAGGCACAGACACCTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926761428 Original CRISPR CAGGCACAGACACCTGGCTG TGG Intergenic
No off target data available for this crispr