ID: 926761942

View in Genome Browser
Species Human (GRCh38)
Location 2:16285785-16285807
Sequence CTGCAGTCCCTGGGCAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926761935_926761942 4 Left 926761935 2:16285758-16285780 CCCAGGTGGTGCAAGCGATGGTG No data
Right 926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG No data
926761936_926761942 3 Left 926761936 2:16285759-16285781 CCAGGTGGTGCAAGCGATGGTGG No data
Right 926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG No data
926761934_926761942 5 Left 926761934 2:16285757-16285779 CCCCAGGTGGTGCAAGCGATGGT No data
Right 926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926761942 Original CRISPR CTGCAGTCCCTGGGCAGGTC AGG Intergenic
No off target data available for this crispr