ID: 926762049

View in Genome Browser
Species Human (GRCh38)
Location 2:16286740-16286762
Sequence CCTGATTATGAGTTATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926762049_926762054 -9 Left 926762049 2:16286740-16286762 CCCTCCAATAACTCATAATCAGG No data
Right 926762054 2:16286754-16286776 ATAATCAGGAGAGGATTAACAGG No data
926762049_926762055 19 Left 926762049 2:16286740-16286762 CCCTCCAATAACTCATAATCAGG No data
Right 926762055 2:16286782-16286804 GAACACCTTTCCCAAAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926762049 Original CRISPR CCTGATTATGAGTTATTGGA GGG (reversed) Intergenic
No off target data available for this crispr