ID: 926771714

View in Genome Browser
Species Human (GRCh38)
Location 2:16383558-16383580
Sequence ACTTCTTGGCAGAGGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926771706_926771714 18 Left 926771706 2:16383517-16383539 CCATTACTGTTCATCATATAAGG No data
Right 926771714 2:16383558-16383580 ACTTCTTGGCAGAGGTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926771714 Original CRISPR ACTTCTTGGCAGAGGTTGGG GGG Intergenic
No off target data available for this crispr