ID: 926773167

View in Genome Browser
Species Human (GRCh38)
Location 2:16396398-16396420
Sequence GTTTTGCGGGCTCCAGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926773167_926773175 16 Left 926773167 2:16396398-16396420 CCAGACCCTGGAGCCCGCAAAAC No data
Right 926773175 2:16396437-16396459 GGGAAAATCCCTCCTGTGATGGG No data
926773167_926773174 15 Left 926773167 2:16396398-16396420 CCAGACCCTGGAGCCCGCAAAAC No data
Right 926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG No data
926773167_926773172 -5 Left 926773167 2:16396398-16396420 CCAGACCCTGGAGCCCGCAAAAC No data
Right 926773172 2:16396416-16396438 AAAACTCGAGATCAGAGCAGAGG No data
926773167_926773173 -4 Left 926773167 2:16396398-16396420 CCAGACCCTGGAGCCCGCAAAAC No data
Right 926773173 2:16396417-16396439 AAACTCGAGATCAGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926773167 Original CRISPR GTTTTGCGGGCTCCAGGGTC TGG (reversed) Intergenic
No off target data available for this crispr