ID: 926773169

View in Genome Browser
Species Human (GRCh38)
Location 2:16396404-16396426
Sequence TCTCGAGTTTTGCGGGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926773169_926773174 9 Left 926773169 2:16396404-16396426 CCTGGAGCCCGCAAAACTCGAGA No data
Right 926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG No data
926773169_926773179 30 Left 926773169 2:16396404-16396426 CCTGGAGCCCGCAAAACTCGAGA No data
Right 926773179 2:16396457-16396479 GGGCGTTGAGACCAAGAGAGTGG No data
926773169_926773173 -10 Left 926773169 2:16396404-16396426 CCTGGAGCCCGCAAAACTCGAGA No data
Right 926773173 2:16396417-16396439 AAACTCGAGATCAGAGCAGAGGG No data
926773169_926773175 10 Left 926773169 2:16396404-16396426 CCTGGAGCCCGCAAAACTCGAGA No data
Right 926773175 2:16396437-16396459 GGGAAAATCCCTCCTGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926773169 Original CRISPR TCTCGAGTTTTGCGGGCTCC AGG (reversed) Intergenic
No off target data available for this crispr