ID: 926773170

View in Genome Browser
Species Human (GRCh38)
Location 2:16396411-16396433
Sequence GCTCTGATCTCGAGTTTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926773170_926773183 30 Left 926773170 2:16396411-16396433 CCCGCAAAACTCGAGATCAGAGC No data
Right 926773183 2:16396464-16396486 GAGACCAAGAGAGTGGGGAAGGG No data
926773170_926773179 23 Left 926773170 2:16396411-16396433 CCCGCAAAACTCGAGATCAGAGC No data
Right 926773179 2:16396457-16396479 GGGCGTTGAGACCAAGAGAGTGG No data
926773170_926773181 25 Left 926773170 2:16396411-16396433 CCCGCAAAACTCGAGATCAGAGC No data
Right 926773181 2:16396459-16396481 GCGTTGAGACCAAGAGAGTGGGG No data
926773170_926773174 2 Left 926773170 2:16396411-16396433 CCCGCAAAACTCGAGATCAGAGC No data
Right 926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG No data
926773170_926773175 3 Left 926773170 2:16396411-16396433 CCCGCAAAACTCGAGATCAGAGC No data
Right 926773175 2:16396437-16396459 GGGAAAATCCCTCCTGTGATGGG No data
926773170_926773182 29 Left 926773170 2:16396411-16396433 CCCGCAAAACTCGAGATCAGAGC No data
Right 926773182 2:16396463-16396485 TGAGACCAAGAGAGTGGGGAAGG No data
926773170_926773180 24 Left 926773170 2:16396411-16396433 CCCGCAAAACTCGAGATCAGAGC No data
Right 926773180 2:16396458-16396480 GGCGTTGAGACCAAGAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926773170 Original CRISPR GCTCTGATCTCGAGTTTTGC GGG (reversed) Intergenic
No off target data available for this crispr