ID: 926773171

View in Genome Browser
Species Human (GRCh38)
Location 2:16396412-16396434
Sequence TGCTCTGATCTCGAGTTTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926773171_926773181 24 Left 926773171 2:16396412-16396434 CCGCAAAACTCGAGATCAGAGCA No data
Right 926773181 2:16396459-16396481 GCGTTGAGACCAAGAGAGTGGGG No data
926773171_926773174 1 Left 926773171 2:16396412-16396434 CCGCAAAACTCGAGATCAGAGCA No data
Right 926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG No data
926773171_926773179 22 Left 926773171 2:16396412-16396434 CCGCAAAACTCGAGATCAGAGCA No data
Right 926773179 2:16396457-16396479 GGGCGTTGAGACCAAGAGAGTGG No data
926773171_926773180 23 Left 926773171 2:16396412-16396434 CCGCAAAACTCGAGATCAGAGCA No data
Right 926773180 2:16396458-16396480 GGCGTTGAGACCAAGAGAGTGGG No data
926773171_926773175 2 Left 926773171 2:16396412-16396434 CCGCAAAACTCGAGATCAGAGCA No data
Right 926773175 2:16396437-16396459 GGGAAAATCCCTCCTGTGATGGG No data
926773171_926773183 29 Left 926773171 2:16396412-16396434 CCGCAAAACTCGAGATCAGAGCA No data
Right 926773183 2:16396464-16396486 GAGACCAAGAGAGTGGGGAAGGG No data
926773171_926773182 28 Left 926773171 2:16396412-16396434 CCGCAAAACTCGAGATCAGAGCA No data
Right 926773182 2:16396463-16396485 TGAGACCAAGAGAGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926773171 Original CRISPR TGCTCTGATCTCGAGTTTTG CGG (reversed) Intergenic
No off target data available for this crispr