ID: 926773174

View in Genome Browser
Species Human (GRCh38)
Location 2:16396436-16396458
Sequence AGGGAAAATCCCTCCTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926773167_926773174 15 Left 926773167 2:16396398-16396420 CCAGACCCTGGAGCCCGCAAAAC No data
Right 926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG No data
926773169_926773174 9 Left 926773169 2:16396404-16396426 CCTGGAGCCCGCAAAACTCGAGA No data
Right 926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG No data
926773171_926773174 1 Left 926773171 2:16396412-16396434 CCGCAAAACTCGAGATCAGAGCA No data
Right 926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG No data
926773166_926773174 16 Left 926773166 2:16396397-16396419 CCCAGACCCTGGAGCCCGCAAAA No data
Right 926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG No data
926773168_926773174 10 Left 926773168 2:16396403-16396425 CCCTGGAGCCCGCAAAACTCGAG No data
Right 926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG No data
926773170_926773174 2 Left 926773170 2:16396411-16396433 CCCGCAAAACTCGAGATCAGAGC No data
Right 926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926773174 Original CRISPR AGGGAAAATCCCTCCTGTGA TGG Intergenic
No off target data available for this crispr