ID: 926775561

View in Genome Browser
Species Human (GRCh38)
Location 2:16419145-16419167
Sequence CAGCCACCCTGGGACAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926775556_926775561 -3 Left 926775556 2:16419125-16419147 CCACCTGAAAAAGATCAGCACAG No data
Right 926775561 2:16419145-16419167 CAGCCACCCTGGGACAGAGGTGG No data
926775557_926775561 -6 Left 926775557 2:16419128-16419150 CCTGAAAAAGATCAGCACAGCCA No data
Right 926775561 2:16419145-16419167 CAGCCACCCTGGGACAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926775561 Original CRISPR CAGCCACCCTGGGACAGAGG TGG Intergenic