ID: 926775564

View in Genome Browser
Species Human (GRCh38)
Location 2:16419148-16419170
Sequence GCCCCACCTCTGTCCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926775564_926775568 13 Left 926775564 2:16419148-16419170 CCACCCTGGGACAGAGGTGGGGC No data
Right 926775568 2:16419184-16419206 TCCCCATGCACTGTATTACCAGG No data
926775564_926775570 14 Left 926775564 2:16419148-16419170 CCACCCTGGGACAGAGGTGGGGC No data
Right 926775570 2:16419185-16419207 CCCCATGCACTGTATTACCAGGG No data
926775564_926775573 20 Left 926775564 2:16419148-16419170 CCACCCTGGGACAGAGGTGGGGC No data
Right 926775573 2:16419191-16419213 GCACTGTATTACCAGGGTCTAGG No data
926775564_926775574 30 Left 926775564 2:16419148-16419170 CCACCCTGGGACAGAGGTGGGGC No data
Right 926775574 2:16419201-16419223 ACCAGGGTCTAGGCACCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926775564 Original CRISPR GCCCCACCTCTGTCCCAGGG TGG (reversed) Intergenic