ID: 926775565

View in Genome Browser
Species Human (GRCh38)
Location 2:16419151-16419173
Sequence AGTGCCCCACCTCTGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926775565_926775568 10 Left 926775565 2:16419151-16419173 CCCTGGGACAGAGGTGGGGCACT No data
Right 926775568 2:16419184-16419206 TCCCCATGCACTGTATTACCAGG No data
926775565_926775574 27 Left 926775565 2:16419151-16419173 CCCTGGGACAGAGGTGGGGCACT No data
Right 926775574 2:16419201-16419223 ACCAGGGTCTAGGCACCCAATGG No data
926775565_926775570 11 Left 926775565 2:16419151-16419173 CCCTGGGACAGAGGTGGGGCACT No data
Right 926775570 2:16419185-16419207 CCCCATGCACTGTATTACCAGGG No data
926775565_926775573 17 Left 926775565 2:16419151-16419173 CCCTGGGACAGAGGTGGGGCACT No data
Right 926775573 2:16419191-16419213 GCACTGTATTACCAGGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926775565 Original CRISPR AGTGCCCCACCTCTGTCCCA GGG (reversed) Intergenic
No off target data available for this crispr