ID: 926775566

View in Genome Browser
Species Human (GRCh38)
Location 2:16419152-16419174
Sequence CAGTGCCCCACCTCTGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926775566_926775570 10 Left 926775566 2:16419152-16419174 CCTGGGACAGAGGTGGGGCACTG No data
Right 926775570 2:16419185-16419207 CCCCATGCACTGTATTACCAGGG No data
926775566_926775573 16 Left 926775566 2:16419152-16419174 CCTGGGACAGAGGTGGGGCACTG No data
Right 926775573 2:16419191-16419213 GCACTGTATTACCAGGGTCTAGG No data
926775566_926775568 9 Left 926775566 2:16419152-16419174 CCTGGGACAGAGGTGGGGCACTG No data
Right 926775568 2:16419184-16419206 TCCCCATGCACTGTATTACCAGG No data
926775566_926775574 26 Left 926775566 2:16419152-16419174 CCTGGGACAGAGGTGGGGCACTG No data
Right 926775574 2:16419201-16419223 ACCAGGGTCTAGGCACCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926775566 Original CRISPR CAGTGCCCCACCTCTGTCCC AGG (reversed) Intergenic
No off target data available for this crispr