ID: 926775570

View in Genome Browser
Species Human (GRCh38)
Location 2:16419185-16419207
Sequence CCCCATGCACTGTATTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926775564_926775570 14 Left 926775564 2:16419148-16419170 CCACCCTGGGACAGAGGTGGGGC No data
Right 926775570 2:16419185-16419207 CCCCATGCACTGTATTACCAGGG No data
926775566_926775570 10 Left 926775566 2:16419152-16419174 CCTGGGACAGAGGTGGGGCACTG No data
Right 926775570 2:16419185-16419207 CCCCATGCACTGTATTACCAGGG No data
926775565_926775570 11 Left 926775565 2:16419151-16419173 CCCTGGGACAGAGGTGGGGCACT No data
Right 926775570 2:16419185-16419207 CCCCATGCACTGTATTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926775570 Original CRISPR CCCCATGCACTGTATTACCA GGG Intergenic