ID: 926775573

View in Genome Browser
Species Human (GRCh38)
Location 2:16419191-16419213
Sequence GCACTGTATTACCAGGGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926775564_926775573 20 Left 926775564 2:16419148-16419170 CCACCCTGGGACAGAGGTGGGGC No data
Right 926775573 2:16419191-16419213 GCACTGTATTACCAGGGTCTAGG No data
926775565_926775573 17 Left 926775565 2:16419151-16419173 CCCTGGGACAGAGGTGGGGCACT No data
Right 926775573 2:16419191-16419213 GCACTGTATTACCAGGGTCTAGG No data
926775566_926775573 16 Left 926775566 2:16419152-16419174 CCTGGGACAGAGGTGGGGCACTG No data
Right 926775573 2:16419191-16419213 GCACTGTATTACCAGGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926775573 Original CRISPR GCACTGTATTACCAGGGTCT AGG Intergenic