ID: 926775574

View in Genome Browser
Species Human (GRCh38)
Location 2:16419201-16419223
Sequence ACCAGGGTCTAGGCACCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926775565_926775574 27 Left 926775565 2:16419151-16419173 CCCTGGGACAGAGGTGGGGCACT No data
Right 926775574 2:16419201-16419223 ACCAGGGTCTAGGCACCCAATGG No data
926775572_926775574 -9 Left 926775572 2:16419187-16419209 CCATGCACTGTATTACCAGGGTC No data
Right 926775574 2:16419201-16419223 ACCAGGGTCTAGGCACCCAATGG No data
926775564_926775574 30 Left 926775564 2:16419148-16419170 CCACCCTGGGACAGAGGTGGGGC No data
Right 926775574 2:16419201-16419223 ACCAGGGTCTAGGCACCCAATGG No data
926775566_926775574 26 Left 926775566 2:16419152-16419174 CCTGGGACAGAGGTGGGGCACTG No data
Right 926775574 2:16419201-16419223 ACCAGGGTCTAGGCACCCAATGG No data
926775569_926775574 -7 Left 926775569 2:16419185-16419207 CCCCATGCACTGTATTACCAGGG No data
Right 926775574 2:16419201-16419223 ACCAGGGTCTAGGCACCCAATGG No data
926775571_926775574 -8 Left 926775571 2:16419186-16419208 CCCATGCACTGTATTACCAGGGT No data
Right 926775574 2:16419201-16419223 ACCAGGGTCTAGGCACCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926775574 Original CRISPR ACCAGGGTCTAGGCACCCAA TGG Intergenic