ID: 926776779

View in Genome Browser
Species Human (GRCh38)
Location 2:16430962-16430984
Sequence CTGTATCCACTGCTGAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926776777_926776779 -9 Left 926776777 2:16430948-16430970 CCAAGAAGCCTTGTCTGTATCCA No data
Right 926776779 2:16430962-16430984 CTGTATCCACTGCTGAAGTTAGG No data
926776776_926776779 -6 Left 926776776 2:16430945-16430967 CCTCCAAGAAGCCTTGTCTGTAT No data
Right 926776779 2:16430962-16430984 CTGTATCCACTGCTGAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926776779 Original CRISPR CTGTATCCACTGCTGAAGTT AGG Intergenic
No off target data available for this crispr