ID: 926787697

View in Genome Browser
Species Human (GRCh38)
Location 2:16534562-16534584
Sequence AACTGATTGAAGTAGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926787697_926787701 19 Left 926787697 2:16534562-16534584 CCACCACACTACTTCAATCAGTT No data
Right 926787701 2:16534604-16534626 ACCCTACTGTAATTCTAGGTAGG No data
926787697_926787700 15 Left 926787697 2:16534562-16534584 CCACCACACTACTTCAATCAGTT No data
Right 926787700 2:16534600-16534622 TTTTACCCTACTGTAATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926787697 Original CRISPR AACTGATTGAAGTAGTGTGG TGG (reversed) Intergenic
No off target data available for this crispr