ID: 926794590

View in Genome Browser
Species Human (GRCh38)
Location 2:16608435-16608457
Sequence TGCGATCTTAAAATAGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926794590_926794594 11 Left 926794590 2:16608435-16608457 CCCTCATCTATTTTAAGATCGCA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 926794594 2:16608469-16608491 ATAGATGGCCAAGTGGAATGAGG 0: 1
1: 0
2: 1
3: 11
4: 174
926794590_926794593 4 Left 926794590 2:16608435-16608457 CCCTCATCTATTTTAAGATCGCA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 926794593 2:16608462-16608484 TCAGTTTATAGATGGCCAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 144
926794590_926794595 15 Left 926794590 2:16608435-16608457 CCCTCATCTATTTTAAGATCGCA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG 0: 1
1: 0
2: 2
3: 25
4: 294
926794590_926794597 30 Left 926794590 2:16608435-16608457 CCCTCATCTATTTTAAGATCGCA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 926794597 2:16608488-16608510 GAGGACGGCGTTTTGTAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
926794590_926794592 -4 Left 926794590 2:16608435-16608457 CCCTCATCTATTTTAAGATCGCA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 926794592 2:16608454-16608476 CGCAAATTTCAGTTTATAGATGG 0: 1
1: 0
2: 0
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926794590 Original CRISPR TGCGATCTTAAAATAGATGA GGG (reversed) Intronic
901468976 1:9442407-9442429 TTCGGTCTTAAAATACTTGATGG - Intergenic
904707665 1:32403602-32403624 TGGCACCTTAAAATTGATGAAGG + Intergenic
905079946 1:35309671-35309693 TGCGATCTCAAAATACTTTATGG + Intronic
910648157 1:89535609-89535631 TACATTCTTAAAATGGATGACGG - Intronic
911703834 1:100987624-100987646 TCCGAACATAAACTAGATGATGG - Intergenic
912010923 1:104961299-104961321 TGCTCTATTAAAATAAATGAAGG + Intergenic
912285984 1:108369940-108369962 TGCAATTTTAAAGTAGATAAAGG - Intergenic
912340883 1:108913876-108913898 TGAGATCTTAAAATAGAAAGGGG + Intronic
921687729 1:218109264-218109286 TGTGATGTTAAAAGAGTTGAAGG - Intergenic
923602778 1:235418167-235418189 TGCGAACTTAAAAAAAAGGAAGG - Intronic
923994330 1:239475566-239475588 TGGGATCTTAGAATAGAAAAAGG + Intronic
1077574084 11:3366510-3366532 TTTGATTTAAAAATAGATGAAGG + Intronic
1078836285 11:15033825-15033847 TGCAATCTCAAAATAAAAGACGG + Intronic
1084143790 11:67252360-67252382 TGCCATTTTAATACAGATGAAGG + Intronic
1085491407 11:76921853-76921875 TGCTATCTTCAAATATCTGAAGG - Intronic
1086245293 11:84744583-84744605 TTCAATTTTAAAATAGATTAAGG - Intronic
1087156697 11:94911529-94911551 TGTGAACTTAAAATGAATGAAGG + Intergenic
1087993488 11:104774975-104774997 TGGGATCTTAACAGAGCTGAAGG + Intergenic
1090641362 11:128731686-128731708 TGAAATCTTAAAATAGGAGACGG - Intronic
1095118915 12:38390272-38390294 TGAGCTTTTAAAATATATGATGG - Intergenic
1097751029 12:63353196-63353218 TTAGTTCTTAAAATATATGATGG + Intergenic
1102366533 12:112341334-112341356 TCTGATCTTAAAAAAGGTGAAGG - Intronic
1104509160 12:129360486-129360508 TGGGTTCTTAAAAGAGACGAGGG + Intronic
1105582167 13:21708558-21708580 TGCCATCTGGAGATAGATGAGGG + Intergenic
1106543380 13:30710107-30710129 TGTATTCTTAAAATAGAAGAGGG + Intergenic
1112144520 13:96682724-96682746 TGATATTTTAAAATAAATGATGG + Intronic
1113088928 13:106597143-106597165 TGGGATCCTAAAACAGATAAAGG - Intergenic
1116045403 14:39736744-39736766 TGCTATCTTAAAATAAAAGTTGG - Intergenic
1116055953 14:39864069-39864091 TGCTATCTTCAAATATTTGAAGG + Intergenic
1116182327 14:41550913-41550935 CGTGTTCTTAAAATAAATGATGG + Intergenic
1117024339 14:51604981-51605003 TGTGATCTCAAGATACATGAGGG + Intronic
1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG + Intergenic
1117444333 14:55789113-55789135 TCCGATGTTAAAAAAGATGGAGG + Intergenic
1120977269 14:90260018-90260040 TACCACCTGAAAATAGATGATGG + Intronic
1124432218 15:29617568-29617590 TGCGATATTAAGAAACATGATGG + Intergenic
1126167274 15:45664377-45664399 AGCCATCTTCAAATAGCTGAAGG - Intronic
1131573957 15:93567627-93567649 TGTAAACTTTAAATAGATGATGG - Intergenic
1133636125 16:7667487-7667509 TTCGTTTTTAAAAGAGATGATGG + Intronic
1134340049 16:13336535-13336557 TGCTTTCTTAAAATAGTTGGAGG + Intergenic
1135643667 16:24142836-24142858 TGGGATCTTAAGATAGAGGGAGG + Intronic
1138777162 16:59736957-59736979 TGAGATCTAAAAACAGAAGATGG - Intronic
1144169080 17:12641326-12641348 TGCTAACTGAAAATAGATGGTGG - Intergenic
1149897904 17:60444451-60444473 TGCGATCTTAGAAATAATGAAGG - Exonic
1150230549 17:63547491-63547513 TGTGTTTTTAAAATAGATGGTGG - Intronic
1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG + Intronic
1159156140 18:64585680-64585702 TGTGAACTTAAAATTGATGCAGG - Intergenic
1159326809 18:66931003-66931025 TGCAATCTTAGACTAGGTGAGGG - Intergenic
1160095562 18:75869221-75869243 TGAGATCTTAATAGACATGATGG - Intergenic
925149636 2:1606348-1606370 TGGGATATTAAAGTACATGACGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
928879176 2:36077924-36077946 TGAGTTGCTAAAATAGATGAGGG + Intergenic
930749324 2:54917726-54917748 TGTGATCTTACTACAGATGACGG - Intronic
933017702 2:77150512-77150534 TGAGATCTTAAAATGAATGAGGG - Intronic
935483548 2:103623725-103623747 AGAGATCTTCACATAGATGAGGG - Intergenic
936056867 2:109268160-109268182 TGTGATGTTAAAAGAGATGGAGG + Intronic
937187411 2:120057334-120057356 TTAGATTTTAAAATAGACGATGG - Intronic
939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG + Intronic
942226590 2:173822062-173822084 TGCCCTCTTAAAGTAGATGGAGG - Intergenic
1171299430 20:24047170-24047192 TTCCATCTTGAGATAGATGAAGG - Intergenic
1176946684 21:14990611-14990633 TGAAATCTTAAAAGAGATGCTGG + Intronic
1178560919 21:33639033-33639055 TGAGATCTAAAGATAGATAAAGG + Intronic
950917937 3:16664619-16664641 TGCCATCTTAAGCTAGATAAAGG - Intronic
951433116 3:22631075-22631097 AGAGATATTAAAATAGATCATGG - Intergenic
957575994 3:82009111-82009133 TGCGTTCTTAAAATAAATGGGGG + Intergenic
957885107 3:86277314-86277336 TGTGATTTTAAAATACATGCTGG + Intergenic
959743699 3:109751551-109751573 TGAGTTCTGAAAATAGATAATGG - Intergenic
959757853 3:109920591-109920613 TTCAATATTAATATAGATGAAGG + Intergenic
964281338 3:155069808-155069830 TAGGATATTAAAATAGCTGAAGG - Intronic
971496390 4:27270375-27270397 TGTGATCTTAAAATATTTGAGGG - Intergenic
976681178 4:87757858-87757880 TGAGATATTAAAACAGATGCTGG - Intergenic
977705071 4:100061659-100061681 TGCACTCTTAAAAAAGATTAGGG - Intergenic
978250386 4:106624003-106624025 TTCGATCTTGGATTAGATGAAGG - Intergenic
980188927 4:129497685-129497707 TGAGATCTTAAACTGGTTGAGGG + Intergenic
981032791 4:140142692-140142714 TGCTTTCTTAAAATATTTGAAGG - Intronic
982457690 4:155629567-155629589 TGAGATCTCAAAATAGATTTAGG - Intergenic
989271790 5:39541968-39541990 TTCGATCTTAGAATAAATGGAGG - Intergenic
992353872 5:75958987-75959009 TGAGGTCTTAAAATATTTGAGGG - Intergenic
993026006 5:82647409-82647431 AGCTTTCTTAAAATAAATGAAGG + Intergenic
993306032 5:86276702-86276724 TGCAATTTTAAAGTAGATAAAGG - Intergenic
993661863 5:90647433-90647455 TGTGATCTGAAAATATGTGATGG + Intronic
996020399 5:118584997-118585019 TGCATTTTTAAAACAGATGATGG + Intergenic
996820423 5:127620334-127620356 TGACATCTGAAAATAGATCATGG + Intergenic
997125303 5:131220650-131220672 TGCGATCACAAAATAAATCAAGG + Intergenic
1000000593 5:157135087-157135109 TGCAAACTTAAAAAAAATGAGGG - Intronic
1003033342 6:2621647-2621669 TTCTATCTTAAAACATATGAAGG - Intergenic
1004230737 6:13830979-13831001 TACCATCTGCAAATAGATGATGG + Intergenic
1006593752 6:35177648-35177670 TGGGACCTTAAAAGAGATCAAGG - Intergenic
1007497662 6:42271975-42271997 TGCGTTTTTAAAATGGATGACGG + Intronic
1008463775 6:51806673-51806695 CGTTATCTAAAAATAGATGAGGG + Intronic
1008832377 6:55781192-55781214 TACTTTCTTAAAATAAATGAGGG - Intronic
1010650892 6:78454752-78454774 TGAGTTCTTACAATATATGATGG - Intergenic
1012995639 6:105970505-105970527 TGCGTACTTAAAATAATTGAAGG - Intergenic
1016716695 6:147240696-147240718 TGTGAACTTAAAGTAGAGGAAGG + Intronic
1018943828 6:168330866-168330888 TGCGATCTTGTTATAGATGCAGG + Intergenic
1020466540 7:8486038-8486060 TGGGATTTTAAAACATATGATGG + Intronic
1022257838 7:28677092-28677114 TTTTATCTTAAAATAGAAGAGGG + Intronic
1022465658 7:30651881-30651903 GGTGTTTTTAAAATAGATGAGGG + Intergenic
1024402300 7:48939053-48939075 TGGTATCTAAAAACAGATGAAGG - Intergenic
1026822430 7:73558249-73558271 TGCGATCATATCATAGCTGACGG - Intergenic
1027468816 7:78548383-78548405 AGCAATCTTAAAATACATGGAGG - Intronic
1027712329 7:81620747-81620769 TGCCATCTTAATATATATGATGG - Intergenic
1030907857 7:115208783-115208805 TGAAATCTTAAGAGAGATGAAGG + Intergenic
1034696329 7:153057259-153057281 AGTGATCATAAAAAAGATGAAGG + Intergenic
1035132229 7:156666166-156666188 TGAGATCCTAAAACATATGAGGG - Intronic
1042826786 8:72987552-72987574 TGTAATCTTAAAGTAGGTGAGGG + Intergenic
1043302294 8:78748875-78748897 TGGAATGGTAAAATAGATGATGG + Intronic
1046404210 8:113751222-113751244 TGCCATCTTAGAATATATGTGGG + Intergenic
1048823529 8:138400930-138400952 AGAGATCTTAAAATGGTTGATGG - Intronic
1056002801 9:82234847-82234869 TGGGATATTCAAACAGATGATGG - Intergenic
1056081569 9:83099964-83099986 TGATATCTTAAATAAGATGATGG - Intergenic
1058284587 9:103160945-103160967 TGCAATCTCAAAAATGATGATGG - Intergenic
1185664333 X:1752778-1752800 GGCCATCTTAAAAGAGCTGATGG + Intergenic
1187469728 X:19558509-19558531 TGATATTTTAAAATGGATGATGG - Intronic
1193919281 X:87406153-87406175 TGAGAACTTAAAATGGTTGAAGG + Intergenic
1194555733 X:95356457-95356479 TGCGGACTGAAAATAGAGGAAGG - Intergenic
1194778564 X:97994977-97994999 TGTGATCTTAAAATATCTAAGGG + Intergenic
1195755572 X:108195725-108195747 GGAGATCTTTAAATAGATTATGG + Intronic
1201249064 Y:12037591-12037613 TCTGATCCTAAAATAGAAGACGG + Intergenic