ID: 926794591

View in Genome Browser
Species Human (GRCh38)
Location 2:16608436-16608458
Sequence TTGCGATCTTAAAATAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926794591_926794594 10 Left 926794591 2:16608436-16608458 CCTCATCTATTTTAAGATCGCAA 0: 1
1: 0
2: 2
3: 12
4: 96
Right 926794594 2:16608469-16608491 ATAGATGGCCAAGTGGAATGAGG 0: 1
1: 0
2: 1
3: 11
4: 174
926794591_926794593 3 Left 926794591 2:16608436-16608458 CCTCATCTATTTTAAGATCGCAA 0: 1
1: 0
2: 2
3: 12
4: 96
Right 926794593 2:16608462-16608484 TCAGTTTATAGATGGCCAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 144
926794591_926794592 -5 Left 926794591 2:16608436-16608458 CCTCATCTATTTTAAGATCGCAA 0: 1
1: 0
2: 2
3: 12
4: 96
Right 926794592 2:16608454-16608476 CGCAAATTTCAGTTTATAGATGG 0: 1
1: 0
2: 0
3: 13
4: 108
926794591_926794597 29 Left 926794591 2:16608436-16608458 CCTCATCTATTTTAAGATCGCAA 0: 1
1: 0
2: 2
3: 12
4: 96
Right 926794597 2:16608488-16608510 GAGGACGGCGTTTTGTAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
926794591_926794595 14 Left 926794591 2:16608436-16608458 CCTCATCTATTTTAAGATCGCAA 0: 1
1: 0
2: 2
3: 12
4: 96
Right 926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG 0: 1
1: 0
2: 2
3: 25
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926794591 Original CRISPR TTGCGATCTTAAAATAGATG AGG (reversed) Intronic
901955112 1:12778411-12778433 TTGCAATATTAAAATAGTTGTGG + Intergenic
902369436 1:15996519-15996541 TTGATATCTCAAAAGAGATGGGG - Intergenic
909607462 1:77521527-77521549 TTGGCATCTTAGATTAGATGAGG - Intronic
910702007 1:90085599-90085621 TTGCAACCTTAAAAGAGATGGGG - Intergenic
911210909 1:95137194-95137216 TCTCCCTCTTAAAATAGATGAGG - Intronic
911515972 1:98868389-98868411 TTGGGATCTTAAAGTAGATGGGG - Intergenic
911665153 1:100543471-100543493 TTGAGATGTTAAAATGGAGGGGG - Intergenic
912249879 1:108000199-108000221 TTGCCTTCTTAAAACAAATGTGG - Intergenic
912340882 1:108913875-108913897 ATGAGATCTTAAAATAGAAAGGG + Intronic
912669256 1:111608990-111609012 TTGTGATCTTAAAATCGCTCAGG - Intronic
912684154 1:111748914-111748936 TTGGGACCTAAGAATAGATGCGG + Intronic
923188843 1:231600021-231600043 TTACGATTTTAAATGAGATGTGG - Intronic
924321839 1:242858713-242858735 TTGGATTCTTAATATAGATGGGG + Intergenic
1072235316 10:93448561-93448583 TTGCCATGCTAAAATAGATAAGG + Intronic
1072474514 10:95747010-95747032 TAGGGATCATAAAAAAGATGGGG + Intronic
1074131478 10:110581907-110581929 TTGCCCTCTTAAAAGAAATGGGG - Exonic
1081517626 11:43848789-43848811 TTGGGATGTGAAAATAGAGGTGG - Intronic
1086371931 11:86163749-86163771 TTGCACTTTTAAAAGAGATGGGG + Intergenic
1090889554 11:130911394-130911416 TTTTAATCTTAAACTAGATGGGG + Intronic
1091330285 11:134726459-134726481 TTGTGATCACAAAAAAGATGAGG + Intergenic
1093102070 12:15039127-15039149 TTAAGATTTTAACATAGATGTGG + Intergenic
1097789628 12:63801114-63801136 TTGCTATCATAAATTTGATGTGG + Intronic
1098056572 12:66512426-66512448 TTAAGATCTTAAATTAGATAAGG - Intronic
1098969105 12:76830617-76830639 TTGTAAGCTTAAAATAGATGAGG - Intronic
1101665794 12:106812927-106812949 TTGCGTTCTCTAAATAGATGTGG - Intronic
1102227766 12:111241002-111241024 TTGCTATCATAAAATACCTGAGG + Intronic
1103171840 12:118827498-118827520 CTGAGCTCTGAAAATAGATGTGG - Intergenic
1103426090 12:120835748-120835770 TTGTGATCCTAAAATAGCAGGGG - Intronic
1105493340 13:20908096-20908118 TTTAGATCCTAAAATAGAAGAGG + Intergenic
1111095146 13:83503867-83503889 TTGCTATCTTAAATTAGCTGAGG - Intergenic
1112131178 13:96525236-96525258 TTTCTATTTAAAAATAGATGGGG + Intronic
1112427455 13:99316154-99316176 TTGAGATCAGAAAATAGAGGTGG + Intronic
1115301382 14:31889346-31889368 TTGCTTTCTTAAAATTTATGTGG + Intergenic
1117101048 14:52348032-52348054 TTTTTTTCTTAAAATAGATGGGG - Intergenic
1120466582 14:84865284-84865306 TTGGGATCTTATAATATCTGAGG - Intergenic
1127611647 15:60642982-60643004 TTGCGTTTTTAAAAGAGGTGGGG - Intronic
1138923275 16:61558756-61558778 TTTTGATATTAAAATAGATTGGG - Intergenic
1141252874 16:82374728-82374750 TTGCAATCTTAAAAAATATTAGG - Intergenic
1146043952 17:29486458-29486480 TTGCGGTTTTAGTATAGATGAGG - Intronic
1147537576 17:41330888-41330910 TTGATATCTAAAAAGAGATGGGG - Intergenic
1150691049 17:67367244-67367266 TTGAGATCTTAAAAAAGCTTAGG + Intergenic
1153559697 18:6359655-6359677 TTGAGAGTTTAAAATAGATTTGG - Intronic
1156921583 18:42529079-42529101 TTGGTGTCTTAAAATAGATGTGG + Intergenic
1157697951 18:49738640-49738662 CTTTGATCTTAAAATAAATGAGG - Intergenic
1158794853 18:60832506-60832528 TTGCGAAGTTAAAATATATTTGG + Intergenic
1163454071 19:17395640-17395662 TTGTGTTTTTAAAAGAGATGAGG - Intergenic
1163832671 19:19554527-19554549 GGGCGATCTTACAATAGAAGAGG - Intergenic
1168369265 19:55818230-55818252 ATGAGATCTAAAAATAGATGTGG + Exonic
1168488464 19:56786146-56786168 TTGCGATATTAAAATGTATGGGG - Intronic
926794591 2:16608436-16608458 TTGCGATCTTAAAATAGATGAGG - Intronic
926842504 2:17097773-17097795 TTGAAATCTTAAAATACAGGAGG + Intergenic
926954661 2:18281251-18281273 TTGGGGTCTTAAAATTAATGCGG - Intronic
927579487 2:24229414-24229436 TTGCGTTTTTAATAGAGATGGGG - Intronic
928491160 2:31784731-31784753 TTGTGTTTTTAAAAGAGATGGGG - Intergenic
928879175 2:36077923-36077945 TTGAGTTGCTAAAATAGATGAGG + Intergenic
929042765 2:37761448-37761470 TTGTGATGTCAAAAGAGATGGGG - Intergenic
933017703 2:77150513-77150535 ATGAGATCTTAAAATGAATGAGG - Intronic
936770477 2:115906998-115907020 TTGCAATATAAAAATAGATGAGG + Intergenic
941492217 2:166156287-166156309 TGGCTTTCTTAAAATAGATAGGG - Intergenic
944024964 2:195153430-195153452 TTGCCAAGTTAAAGTAGATGAGG + Intergenic
1173347716 20:42216128-42216150 TTGAGATCTGAGAAGAGATGTGG - Intronic
1185005888 22:48276813-48276835 TTGCGAGCTGAAAATGGAAGTGG + Intergenic
1203294949 22_KI270736v1_random:32937-32959 TTGTGATGTCAAAAGAGATGGGG - Intergenic
951000065 3:17548139-17548161 TTGCGTTTTTAATAGAGATGGGG - Intronic
952202057 3:31140131-31140153 TTGCTTTCTTAGAATGGATGGGG - Intergenic
953986330 3:47446046-47446068 TTGCATTCTTAGAAGAGATGGGG + Intronic
956962271 3:74416813-74416835 TTGTGTTTTTAAAAGAGATGGGG - Intronic
957575993 3:82009110-82009132 TTGCGTTCTTAAAATAAATGGGG + Intergenic
958096046 3:88946296-88946318 TTGCCATCTTAATATAGAGGTGG - Intergenic
960196527 3:114775510-114775532 TTGAGATCTTGCAATACATGTGG + Intronic
964093188 3:152899916-152899938 TTGCATTTTTAATATAGATGGGG + Intergenic
965592984 3:170379814-170379836 TTGCGTTTTTAATAGAGATGGGG + Intronic
971496391 4:27270376-27270398 TTGTGATCTTAAAATATTTGAGG - Intergenic
977705072 4:100061660-100061682 TTGCACTCTTAAAAAAGATTAGG - Intergenic
981472317 4:145150694-145150716 TTGGGTTCTTACAACAGATGTGG - Exonic
981736583 4:147959285-147959307 GTGTGATTTTAAAATAGATTAGG + Intronic
983072263 4:163282486-163282508 TTGAGATCTTAAATAAGATACGG - Intergenic
983308569 4:166025717-166025739 TTTAAATCTTAAAATATATGGGG - Intronic
986512845 5:8526528-8526550 TTACGATGTTAAATTATATGGGG + Intergenic
988041668 5:25896448-25896470 ATGTTATCTTAAAATAAATGTGG - Intergenic
990119086 5:52426769-52426791 TTGCCATCTGAAAATATTTGTGG + Intergenic
992735998 5:79722169-79722191 TTGCAATTTCAAAATACATGAGG - Intronic
994678406 5:102854589-102854611 ATGAGAGCTTAAAAAAGATGAGG - Intronic
1000836388 5:166159993-166160015 GTGCGCTTTTAAATTAGATGTGG - Intergenic
1005707136 6:28466805-28466827 TTGCTTTCTGAAAATTGATGGGG - Intergenic
1005853360 6:29839815-29839837 TTGTGTTTTTAATATAGATGGGG - Intergenic
1008463774 6:51806672-51806694 TCGTTATCTAAAAATAGATGAGG + Intronic
1009409429 6:63348759-63348781 TTGCTTTTTTAAAATAGAGGTGG + Intergenic
1010371059 6:75107712-75107734 ATGCTATCTTGAAATAGTTGAGG - Intronic
1010809006 6:80277337-80277359 GGGTGATATTAAAATAGATGAGG - Intronic
1011957624 6:93042814-93042836 TTGCCATATTAAAACAAATGAGG - Intergenic
1014544879 6:122722900-122722922 TTGTGATCTTGAAATAGCAGTGG - Intronic
1022159453 7:27694178-27694200 TTGCGATAATAAACTAGGTGTGG + Intergenic
1022257837 7:28677091-28677113 TTTTTATCTTAAAATAGAAGAGG + Intronic
1022800181 7:33769543-33769565 TTGGTATCTTAAAATAGCTTGGG + Intergenic
1024847194 7:53660362-53660384 TTGCTATCTTAAAACAAATTAGG - Intergenic
1028086807 7:86645541-86645563 TTGCGATCCAAAAATAGACTAGG + Intronic
1030532910 7:110732467-110732489 TTGAGAGCTTGAAATAGATATGG + Intronic
1031272609 7:119671670-119671692 TTGAGATCTTAAGATAAATAAGG + Intergenic
1042513835 8:69639382-69639404 TTGGGATCTAAAAATATAAGAGG + Intronic
1043822754 8:84888920-84888942 TTGTAATTTTAATATAGATGCGG + Intronic
1046404209 8:113751221-113751243 TTGCCATCTTAGAATATATGTGG + Intergenic
1052224311 9:26066482-26066504 TTGGGATCTAGAAATAGAAGTGG + Intergenic
1053299540 9:36939194-36939216 TTTCTTTCTTAAAATAAATGTGG + Intronic
1055884264 9:81040672-81040694 TTCAGCTCTTAAAATAGATTGGG + Intergenic
1061346544 9:130030849-130030871 TTGCTAGCTTAAAAGAGCTGGGG + Intronic
1061759953 9:132843682-132843704 TTGTTATTTTAAAATAAATGTGG - Intronic
1187063681 X:15812101-15812123 TTGTGTTTTTAATATAGATGGGG + Intronic
1188132849 X:26459084-26459106 TAACGATTTTAAAATAGGTGGGG + Intergenic
1188711217 X:33401537-33401559 TTGTAATGATAAAATAGATGGGG + Intergenic
1194963772 X:100265084-100265106 CTGGGATCTTAAAATACATTTGG - Intergenic