ID: 926794593

View in Genome Browser
Species Human (GRCh38)
Location 2:16608462-16608484
Sequence TCAGTTTATAGATGGCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926794589_926794593 20 Left 926794589 2:16608419-16608441 CCAGAAACGAGGGAATCCCTCAT 0: 1
1: 0
2: 0
3: 1
4: 50
Right 926794593 2:16608462-16608484 TCAGTTTATAGATGGCCAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 144
926794588_926794593 21 Left 926794588 2:16608418-16608440 CCCAGAAACGAGGGAATCCCTCA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 926794593 2:16608462-16608484 TCAGTTTATAGATGGCCAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 144
926794590_926794593 4 Left 926794590 2:16608435-16608457 CCCTCATCTATTTTAAGATCGCA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 926794593 2:16608462-16608484 TCAGTTTATAGATGGCCAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 144
926794591_926794593 3 Left 926794591 2:16608436-16608458 CCTCATCTATTTTAAGATCGCAA 0: 1
1: 0
2: 2
3: 12
4: 96
Right 926794593 2:16608462-16608484 TCAGTTTATAGATGGCCAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926794593 Original CRISPR TCAGTTTATAGATGGCCAAG TGG Intronic
901303103 1:8213897-8213919 TCAGTTTATAGATGAGAAAACGG + Intergenic
901654814 1:10763135-10763157 TCAGTTTATGGAAGGCCCCGCGG - Intronic
902758036 1:18562190-18562212 TCCGTTGATTGATGGCCGAGGGG - Intergenic
904664423 1:32108769-32108791 TCAACCTAAAGATGGCCAAGAGG - Intronic
908132886 1:61093752-61093774 TCAGTTCATTTATGGCTAAGAGG + Intronic
909702652 1:78544489-78544511 TGAGTTTCCAGATGGCTAAGTGG + Intergenic
911173506 1:94795430-94795452 TCAGTTTTCAGATGGCAAATAGG + Intergenic
913697606 1:121342759-121342781 TCAGTTTATAGATGGGCACATGG - Intronic
914139953 1:144937293-144937315 TCAGTTTATAGATGGGCACATGG + Intronic
914319256 1:146543812-146543834 TCAGTATATAGATGGCTAGATGG + Intergenic
914936265 1:151983255-151983277 CCAGTGTAGAGATGGCAAAGTGG - Exonic
918857296 1:189774036-189774058 ACAGTTTATAAATGGATAAGAGG - Intergenic
920484995 1:206361408-206361430 TCAGTTTATAGATGGGCATATGG - Intronic
923802588 1:237224945-237224967 ACAGTTTATAGTTGGCAGAGAGG + Intronic
1062847184 10:717074-717096 TCCGTTTCTAGATTGCTAAGAGG + Intergenic
1063835855 10:10010872-10010894 TCTGTTTGTAAATGGCCAATGGG - Intergenic
1065485093 10:26229527-26229549 TCAGTTTAAAGATAGTCAATAGG + Intronic
1065712223 10:28529623-28529645 GCAGTTTACATATGGCCTAGTGG + Intergenic
1067269974 10:44783117-44783139 TCAGTTTAGACAAGGCCAAAAGG - Intergenic
1067664643 10:48266687-48266709 TCAGTTCAGAGAAGGCCAAGTGG + Intronic
1069579122 10:69553213-69553235 TCGGTTTATATCTGGCCATGGGG + Intergenic
1074427392 10:113363770-113363792 TCAGTTGATAGGTGGGCCAGTGG - Intergenic
1075529845 10:123219861-123219883 TCTGTGTGAAGATGGCCAAGAGG - Intergenic
1078117862 11:8472965-8472987 TCTGTTTATGGAGGACCAAGTGG - Intronic
1080146394 11:28989484-28989506 TCAGTTTGCAGATGGCCTATTGG + Intergenic
1080687194 11:34525288-34525310 CCATTTTATAGAAGGGCAAGTGG + Intergenic
1080725408 11:34894870-34894892 TTAGTTTCTAAATGGACAAGTGG - Intronic
1081007077 11:37757943-37757965 TCATTTTCTAGATTGCCAAAAGG - Intergenic
1081562140 11:44227457-44227479 TTATTTTATAGATGGCAAAATGG + Intronic
1081632154 11:44696459-44696481 TCAGCTTATACATGGCAGAGTGG - Intergenic
1081673727 11:44956312-44956334 CCATTTTATAGATGGCAAAACGG + Intergenic
1082002261 11:47399842-47399864 CCATTGTATAGATGGCAAAGTGG - Intergenic
1082704426 11:56476248-56476270 TCAGTTTGAAGATGTCCCAGAGG - Intergenic
1084773475 11:71359334-71359356 ACAGTTAATAGATGGACAGGTGG - Intergenic
1085725698 11:78952817-78952839 CCATTTTATAGATGGGCAACTGG + Intronic
1086161866 11:83730997-83731019 TCATTTTATAGATAGGCTAGTGG + Intronic
1089732306 11:120526894-120526916 TCAGGTTATAAATGGCTAAAGGG + Intronic
1090982104 11:131732072-131732094 TCAGTTTATAGATGAATACGTGG - Intronic
1091694941 12:2622176-2622198 TCAGTTTCTAGAAGGCCTGGAGG - Intronic
1092101106 12:5884500-5884522 TCAGTACAAAGATGGCCATGGGG - Intronic
1092230233 12:6772206-6772228 GCAGCTTAGAGATGGGCAAGGGG + Intergenic
1094154617 12:27326594-27326616 TCATTTTATAGATGACCATGAGG + Intergenic
1095717769 12:45366537-45366559 TCAGTTTTTATATAGGCAAGAGG + Intronic
1097174032 12:57132566-57132588 TCAGTCCAGAGATTGCCAAGGGG - Intronic
1098967837 12:76811723-76811745 TCAGTCAGCAGATGGCCAAGGGG - Intronic
1099059422 12:77887922-77887944 TCAGTTTTTAGATATCTAAGAGG + Intronic
1099101871 12:78451932-78451954 TCATTTTACAGATGGCAAAGTGG - Intergenic
1103516777 12:121513432-121513454 TCAGTTTCCAGAGGGCGAAGGGG + Intronic
1103951931 12:124556024-124556046 CCATTTTATAGATGGCGAAATGG + Intronic
1106688474 13:32087674-32087696 TCAATCTCTAGATGGCCCAGAGG - Intronic
1108773956 13:53740299-53740321 TAAGTTTAGAAATGGCCAAATGG - Intergenic
1110111030 13:71746336-71746358 TCCCTTTATAGATGACAAAGTGG + Intronic
1110683756 13:78347478-78347500 TTAGTTTTTTGATGGCGAAGGGG + Intergenic
1112809283 13:103199094-103199116 TCACTCTGTAGATGGGCAAGCGG + Intergenic
1116157313 14:41222386-41222408 TCCATTTATAGATTGCCAAATGG + Intergenic
1124613957 15:31228417-31228439 TCAGGTTGCAGATGGCCACGTGG - Intergenic
1125814415 15:42572310-42572332 TCAGTTTACAGATGAGGAAGTGG + Intergenic
1130830605 15:87594757-87594779 TCAAAGTACAGATGGCCAAGAGG - Intergenic
1130909197 15:88259392-88259414 TCATTTTACAGATGGGAAAGCGG - Intergenic
1130951041 15:88588399-88588421 TAAGTTTCTAGATGTCCAACTGG + Intergenic
1131366141 15:91842803-91842825 TCAGATTAAAGATGGTCAACTGG + Intergenic
1133831192 16:9325142-9325164 TCAGGTTACAGATGAACAAGTGG + Intergenic
1137303682 16:47179979-47180001 TCAGTTTATAGATAGCTGATAGG + Intronic
1137442628 16:48509402-48509424 TCATTTTACAGAGAGCCAAGTGG - Intergenic
1137824410 16:51478623-51478645 TCAATTTAAAAATGGCCAAAAGG - Intergenic
1138787393 16:59863762-59863784 TCAGTCAACAGATGGCAAAGGGG - Intergenic
1140014267 16:71166272-71166294 TCAGTATATAGATGGCTAGATGG - Intronic
1144057386 17:11555092-11555114 GCAGCTTAGAGATGGCTAAGGGG + Intronic
1146383119 17:32346105-32346127 TGAGTTTATAGATAAGCAAGGGG - Intronic
1147004352 17:37389932-37389954 TCAGTTTATATGGGGCCCAGAGG - Intronic
1149058902 17:52397985-52398007 CCAATTTAAAAATGGCCAAGTGG - Intergenic
1153828458 18:8898709-8898731 TCACTTTATGGATGGGGAAGCGG - Intergenic
1156900250 18:42292455-42292477 TCAGTTTACATAGGGCAAAGAGG - Intergenic
1159963913 18:74577888-74577910 TCAGTTAACAAATGGCAAAGGGG - Intronic
1161498664 19:4601046-4601068 TCATTTTATAGATGGGAAACAGG + Intergenic
1166659344 19:44635969-44635991 TCAGTTGACAGATTGCCCAGGGG + Intronic
1168450163 19:56460162-56460184 TCAGTTAATAGATGGGCATTTGG - Intronic
926794593 2:16608462-16608484 TCAGTTTATAGATGGCCAAGTGG + Intronic
927079335 2:19612246-19612268 GCAGTTTATAGGTGTACAAGAGG - Intergenic
930168433 2:48227187-48227209 TCATTTCATAGATGGGCAAACGG + Intergenic
930444725 2:51455899-51455921 TCTATTGAAAGATGGCCAAGTGG + Intergenic
939142369 2:138370206-138370228 TCATATTATAGAAGGCCAACAGG - Intergenic
941492107 2:166155124-166155146 GCAGTTTCTAGATTGCCTAGGGG - Intergenic
941728179 2:168886809-168886831 TCAGTTTATACTTGGCCGGGCGG - Intronic
942240668 2:173962242-173962264 TCAGTTTACAGATGGGGGAGGGG - Intronic
943251915 2:185533690-185533712 TCAAATTAAAGATGGCCAACAGG + Intergenic
946089407 2:217207613-217207635 TCATTTTGCAGATGGGCAAGAGG + Intergenic
947040106 2:225908698-225908720 TCATTTTATAGTTGCCCAATAGG + Intergenic
1170711963 20:18799274-18799296 TGAGTTTAAAGAAAGCCAAGAGG - Intergenic
1171266468 20:23775727-23775749 GCAGGTTAAAGGTGGCCAAGTGG + Intergenic
1172056549 20:32158250-32158272 TCATTTTATAGATGGGCAACTGG - Intronic
1172650415 20:36498232-36498254 TCTGTTTATACATGGGGAAGTGG - Intronic
1180118271 21:45726223-45726245 TCAGGTAACAGATGTCCAAGTGG + Intronic
1181860718 22:25815958-25815980 TCAATTTATAGATGGCACATCGG + Intronic
1182493685 22:30691814-30691836 TCATTTTACAGATGAGCAAGTGG + Intergenic
949395828 3:3613974-3613996 TGAGGTTATAGAGGGCAAAGGGG + Intergenic
949697727 3:6718769-6718791 GGAGGTTATAGATGGGCAAGGGG + Intergenic
949781111 3:7689832-7689854 TCAGTTCATGGATGGCCTAGAGG - Intronic
951225429 3:20115464-20115486 GCAGTTTATATCTGGCCATGGGG + Intronic
959297269 3:104552748-104552770 ACAGTTTATAGATTGCAAAAAGG + Intergenic
959545274 3:107588568-107588590 CCAGTTTATAGGTGGCAAACTGG - Intronic
961196334 3:125004775-125004797 TCACTGTATAGATGACCGAGGGG - Intronic
962286067 3:134086428-134086450 TCAGTTTACAGATGAAAAAGAGG - Intronic
963164475 3:142187043-142187065 CCAGTTTAAAGATGACAAAGAGG + Intronic
965507090 3:169528667-169528689 TTTATTTACAGATGGCCAAGTGG + Intronic
966764368 3:183447127-183447149 TCAGTTTTGAGATGGTTAAGAGG + Intergenic
967080476 3:186045072-186045094 TCAGTTGTTAGATGACAAAGAGG - Intergenic
969467951 4:7368697-7368719 TAAGTTTGAAGTTGGCCAAGAGG + Intronic
971244524 4:24916153-24916175 TCAGTTTTCAGAAAGCCAAGGGG - Intronic
974074271 4:57154707-57154729 TCAGTCTATAGATGGGAAAATGG + Intergenic
975485317 4:74928844-74928866 TCAGTTAGTAGATGGCAGAGGGG + Intergenic
980270961 4:130583169-130583191 TCATTTGAAAGAGGGCCAAGTGG + Intergenic
981097829 4:140799610-140799632 GAAGTTTATAGACAGCCAAGTGG - Intergenic
981124275 4:141088097-141088119 TCAGTTTATATATGACCAAATGG - Intronic
982331277 4:154184566-154184588 TCAGGATATAGATGGTCATGAGG - Intergenic
983511267 4:168611857-168611879 TCAGTGTAAAGATGTCCAACAGG + Intronic
985086595 4:186319627-186319649 TCATGTTATAGATGGCAAACTGG + Intergenic
987452363 5:18101888-18101910 TCAGTTTATTTATGGCTAAATGG + Intergenic
988237656 5:28566335-28566357 TCACTCTTTATATGGCCAAGTGG - Intergenic
988252201 5:28773750-28773772 CTAGTTAATAAATGGCCAAGAGG + Intergenic
995153871 5:108885993-108886015 CATGTTTATAGATGACCAAGTGG + Intronic
996385070 5:122902241-122902263 TCAGGCTATAGAGAGCCAAGAGG - Intronic
996595902 5:125202402-125202424 TCAGTTTTTAGCTGGGCACGTGG + Intergenic
997198581 5:131995817-131995839 TCATTTTAAAGATGGGGAAGTGG - Intronic
997849531 5:137318583-137318605 TAATTGTTTAGATGGCCAAGTGG + Intronic
998049020 5:139015775-139015797 TTAGTTTAGAGATGGCCATGTGG - Intronic
1000190771 5:158908637-158908659 TCATTTTAAATATGGCCAAGAGG + Intronic
1005064089 6:21801471-21801493 TCACTTTAGAGATTTCCAAGAGG - Intergenic
1007607988 6:43130117-43130139 TCAGTTTATACATGGAGAAACGG - Intronic
1009479808 6:64142593-64142615 TAAGTTTATAGAAGGCCATCAGG + Intronic
1010682229 6:78810241-78810263 TCAGTGTGCAGATGGCCTAGTGG - Intergenic
1014280946 6:119441927-119441949 TCATTTTACAGAGAGCCAAGTGG - Intergenic
1015151612 6:130045500-130045522 TCAGTTTACAGATGGGGAAATGG + Intronic
1017802409 6:157909161-157909183 GCAGTTTTCAGATGGGCAAGTGG - Intronic
1017874138 6:158510411-158510433 TCATTTCACAGATGGACAAGTGG - Exonic
1019041507 6:169109630-169109652 TCAGTTAATACAAAGCCAAGTGG + Intergenic
1019223177 6:170490993-170491015 TCAGTTTATAGCAGGCCACCTGG - Intergenic
1021686645 7:23193338-23193360 TCATTTTACAGAGAGCCAAGTGG + Intronic
1029448067 7:100625886-100625908 TAGGTTTGTAAATGGCCAAGGGG + Intronic
1029585194 7:101466221-101466243 TCACTTTATAGATGAGCAAATGG - Intronic
1030623040 7:111813099-111813121 TCAGTTTATAGTAGCTCAAGGGG - Intronic
1032168820 7:129567125-129567147 TCAGCTTATATATGGCAAGGGGG + Intergenic
1035061267 7:156071286-156071308 TCAGTTTATGAATGGACATGGGG + Intergenic
1041246331 8:55891896-55891918 TCATTTAATACATGGCCACGTGG + Intronic
1047929729 8:129714708-129714730 TCAGATGAAAGATGGCTAAGAGG + Intergenic
1048512740 8:135077591-135077613 TCAGTTTTCAGAAGGTCAAGTGG + Intergenic
1049795461 8:144495344-144495366 TCAGTGTGTAGATGGCCATGAGG + Intronic
1053183455 9:35993960-35993982 TGAATTTGTAAATGGCCAAGGGG - Intergenic
1056679427 9:88704390-88704412 TCTGTTTATAGATTTCCAAGCGG - Intergenic
1057994104 9:99804374-99804396 TCTGTTTGAAGATGGGCAAGTGG - Intergenic
1059456570 9:114403620-114403642 TCAGTTTTGACATGGCCAGGTGG - Intronic
1188742682 X:33805625-33805647 TGATTTTATATATGGCAAAGGGG + Intergenic
1192568094 X:72180050-72180072 TCAGGTTATCTATGGCCAAGAGG - Intergenic
1193572316 X:83159870-83159892 TTTTTTTATAAATGGCCAAGGGG - Intergenic
1195449554 X:104995786-104995808 CCAGCTTATAGGTGGCAAAGAGG - Intronic
1195604073 X:106782612-106782634 TCATTTTAGAGATGCTCAAGTGG - Intronic
1195698761 X:107686052-107686074 TCAGTTTCTAGATGGAGAAATGG - Intergenic
1196610199 X:117705511-117705533 TCAGATTTTAGAAGCCCAAGAGG - Intergenic
1199819399 X:151429853-151429875 TCATTTTATAGATTGGGAAGTGG + Intergenic