ID: 926794594

View in Genome Browser
Species Human (GRCh38)
Location 2:16608469-16608491
Sequence ATAGATGGCCAAGTGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926794590_926794594 11 Left 926794590 2:16608435-16608457 CCCTCATCTATTTTAAGATCGCA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 926794594 2:16608469-16608491 ATAGATGGCCAAGTGGAATGAGG 0: 1
1: 0
2: 1
3: 11
4: 174
926794589_926794594 27 Left 926794589 2:16608419-16608441 CCAGAAACGAGGGAATCCCTCAT 0: 1
1: 0
2: 0
3: 1
4: 50
Right 926794594 2:16608469-16608491 ATAGATGGCCAAGTGGAATGAGG 0: 1
1: 0
2: 1
3: 11
4: 174
926794588_926794594 28 Left 926794588 2:16608418-16608440 CCCAGAAACGAGGGAATCCCTCA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 926794594 2:16608469-16608491 ATAGATGGCCAAGTGGAATGAGG 0: 1
1: 0
2: 1
3: 11
4: 174
926794591_926794594 10 Left 926794591 2:16608436-16608458 CCTCATCTATTTTAAGATCGCAA 0: 1
1: 0
2: 2
3: 12
4: 96
Right 926794594 2:16608469-16608491 ATAGATGGCCAAGTGGAATGAGG 0: 1
1: 0
2: 1
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926794594 Original CRISPR ATAGATGGCCAAGTGGAATG AGG Intronic
901159561 1:7164482-7164504 ATAAAGCGCCAAGTGGAGTGAGG - Intronic
908597934 1:65708592-65708614 ATAGATAGCAAGGTGGGATGGGG - Intergenic
908673508 1:66575333-66575355 AAAGTTGGCCAAATGAAATGGGG - Intronic
909899169 1:81110830-81110852 ATAAATGCCAAAATGGAATGGGG + Intergenic
911804539 1:102188900-102188922 ATATTTGAACAAGTGGAATGTGG - Intergenic
911967413 1:104385759-104385781 ATAGATGACTAAGTGGGATCCGG - Intergenic
915079022 1:153338597-153338619 ATAGATGTCAAAGAGGAGTGTGG - Intronic
918216919 1:182399835-182399857 ATAGATTCCCAACAGGAATGAGG + Exonic
923007445 1:230062734-230062756 ATAAATGGACAAGCAGAATGTGG - Intronic
923324160 1:232866089-232866111 TTAGTTGGCCAATTGGAAAGTGG - Intergenic
1064489196 10:15832243-15832265 ACAGAGGGCCAAGTGGGATGAGG + Intronic
1067251124 10:44587832-44587854 ATGCATGGGCAAGTGGAGTGGGG - Intergenic
1068198900 10:53757016-53757038 TTAGATCCCCAAGTGGGATGAGG - Intergenic
1068907065 10:62338522-62338544 ATAGATGGGGAACTGGAAAGGGG - Intergenic
1070106872 10:73441668-73441690 ATAAATGACCAAGAGGAATTTGG + Intronic
1070290213 10:75108979-75109001 GTAGCTGGCCAAGGGGCATGGGG - Intronic
1070538967 10:77402439-77402461 ATTGATGGCAAAATGGAAAGAGG - Intronic
1071715516 10:88091405-88091427 ATAGATGGCAAGGTGGTAGGAGG + Intergenic
1073443055 10:103564223-103564245 ATAAATGCCCAGGAGGAATGGGG + Intronic
1073822301 10:107278220-107278242 TTGGATGGCAAAGTGAAATGTGG + Intergenic
1074127517 10:110541037-110541059 ACAGATGGCCAAAGGGAATATGG - Intergenic
1076561979 10:131372959-131372981 ATGGATGGCCAAGTGGACAATGG + Intergenic
1078268160 11:9770292-9770314 ATAGAGGCCCAAGGGAAATGGGG + Intergenic
1078300580 11:10127484-10127506 ATAGATGGGGAGGTGGACTGTGG - Intronic
1078718121 11:13858940-13858962 ATAGAAGGCCAAGTGGGAGCAGG + Intergenic
1081732982 11:45384653-45384675 ATGGATGGCCATGAGGAATAGGG - Intergenic
1085059086 11:73428034-73428056 ATAAATTGCCCAGTGGAAAGTGG - Intronic
1088283707 11:108164258-108164280 AATGATTGCCAAGTGGAAGGTGG + Intronic
1089950360 11:122519925-122519947 AAATCTGGCCAAGTGGAATCTGG + Intergenic
1090821980 11:130350752-130350774 TTAGTTGGCCAGGTGAAATGGGG - Intergenic
1090949211 11:131458022-131458044 ATAGAAGCCCAAATGGACTGAGG + Intronic
1094096487 12:26710918-26710940 CTGGAAGGCCAACTGGAATGGGG - Intronic
1097318633 12:58201147-58201169 ATAGATGGACAAATGGAATACGG + Intergenic
1099336349 12:81364650-81364672 ATAGATTGTCAAGTTGAATTGGG + Intronic
1101543812 12:105690671-105690693 AAAGATGGGAAAGTGGAAGGGGG - Intergenic
1102724395 12:115046818-115046840 AGAGATAGCCAACTGGATTGAGG - Intergenic
1102882064 12:116493132-116493154 ATAGATTGGCTGGTGGAATGGGG + Intergenic
1105318339 13:19289656-19289678 AGTGATGGCTAAGTGAAATGGGG + Intergenic
1106768226 13:32937460-32937482 GTAGATGGTCAAGGGGAATGGGG - Intergenic
1106960622 13:34993072-34993094 ATAGATAGCAAAGTGGAGAGAGG - Intronic
1107057068 13:36117905-36117927 ATAGATAGCCCAGTGGGAAGTGG - Intronic
1112682850 13:101787021-101787043 ATACATAGCAAAGTGGAATTGGG - Intronic
1116308588 14:43291380-43291402 ACAGATTGCAAAATGGAATGGGG + Intergenic
1118889351 14:69894956-69894978 CTAGCTGGCCAAGTGCACTGGGG - Intronic
1119412608 14:74443320-74443342 ATAAAAGGTCAAGTGAAATGAGG + Intergenic
1125590989 15:40854322-40854344 AGAGAGGGCCAAGTAGAAGGTGG + Intronic
1126437799 15:48653697-48653719 ATAGGTGACCAAATGAAATGTGG - Intergenic
1129569575 15:76666333-76666355 AGAGATGAGAAAGTGGAATGTGG + Intronic
1131611300 15:93967203-93967225 AGAAATGGAAAAGTGGAATGAGG - Intergenic
1132321844 15:100931024-100931046 CAAGATGGCTAAGTGGAATCTGG - Intronic
1134244718 16:12531440-12531462 CCAGATGGCCAAGAGGAAAGGGG + Intronic
1137351734 16:47719220-47719242 ATGGAGGGCCATGTGGAGTGAGG - Intergenic
1137474096 16:48791681-48791703 AGAGATGGCCATGTTGAGTGAGG + Intergenic
1140108282 16:71981099-71981121 ATGGATGGCTAAGTAGAATCTGG - Intronic
1141322648 16:83026241-83026263 ATAGATGGGCAAGTGGAGAAAGG - Intronic
1142470807 17:162297-162319 CAACATGGCCAAGTGGACTGAGG + Intronic
1145041828 17:19582781-19582803 AGGGATGGCCAAGTGGATTAAGG + Intergenic
1145042582 17:19587929-19587951 AGGGATGGCCAAGTGGATTAAGG - Intergenic
1146074553 17:29715981-29716003 ATAGAAGGCCAAGTTAACTGTGG - Intronic
1146886885 17:36476916-36476938 GTTGATGGCCAAGTGGTATGAGG - Intergenic
1148653915 17:49269191-49269213 ATAGATGGACCAGAGTAATGAGG - Intergenic
1153622345 18:6990752-6990774 AAAGATGGGCAGGTGGAATTTGG - Intronic
1153955655 18:10093444-10093466 AAAGATGTCCTAGTGGAAAGCGG + Intergenic
1156591305 18:38491755-38491777 ATAGATGGCCAAGTGGACTCTGG - Intergenic
1156807321 18:41201227-41201249 ATACATGGCAAAGTGTGATGAGG + Intergenic
1157640587 18:49209265-49209287 AAAGATTCCCAAATGGAATGCGG + Intronic
1159037404 18:63290884-63290906 AAAGAGGGCCGAGTGGGATGAGG - Intronic
1159073079 18:63647804-63647826 AAAGAAGGCCAAGAGGAATTAGG - Intronic
1159074649 18:63666555-63666577 AAAGAAGGCCAAGAGGAATCAGG - Intronic
1159177198 18:64853042-64853064 AGAGATGGCTAAATGTAATGTGG - Intergenic
1159753463 18:72332643-72332665 ACAGATTGCAAAGTAGAATGAGG - Intergenic
1159861285 18:73652399-73652421 ATAGAATTCCAAGTGGAATAGGG - Intergenic
1159992450 18:74925587-74925609 ATAGAGGGCCAAGAGGAATTTGG - Intronic
1161555039 19:4936433-4936455 AGAGATGGCCGAGTGGACTCTGG + Intronic
1165602872 19:37072649-37072671 ATAGATGGCCATTGTGAATGAGG + Intronic
1167753596 19:51395746-51395768 ATAGATGCCCACGTGCCATGGGG - Intergenic
1168499680 19:56883119-56883141 ATAAATGGACAATGGGAATGTGG - Intergenic
1168651861 19:58097181-58097203 ATATATGGGAAAGTGGAAGGAGG + Intronic
925595094 2:5547688-5547710 ATAGGTGACAAAGTGGAAGGGGG + Intergenic
926794594 2:16608469-16608491 ATAGATGGCCAAGTGGAATGAGG + Intronic
927356289 2:22177426-22177448 AGAGAAGGGCAGGTGGAATGAGG + Intergenic
927863189 2:26573268-26573290 AAAGATGGCGAAGAGGAAGGCGG - Intronic
934938613 2:98483437-98483459 AGAGATGGTCAAGTGCAAGGTGG + Intronic
936378425 2:111962753-111962775 ATAGATGACTAAATGCAATGTGG - Intronic
937423374 2:121777224-121777246 ATGGATGCCAAAGTAGAATGAGG - Intergenic
937511173 2:122596614-122596636 AGAGATGGCCAAGGGGAACTTGG - Intergenic
939096222 2:137836569-137836591 ATATTTAGACAAGTGGAATGTGG - Intergenic
939813270 2:146862209-146862231 ATAGAAGACCAATTGGAATTTGG + Intergenic
940596757 2:155804082-155804104 ATAGAAGTCCATTTGGAATGAGG + Intergenic
943677534 2:190730823-190730845 ACAGATGCCTTAGTGGAATGAGG - Intergenic
945046258 2:205784533-205784555 ACAGTTGGCCAAGGCGAATGAGG - Intronic
945258282 2:207820585-207820607 TTAGATGGCCAAGTGCCAGGTGG - Intergenic
946461352 2:219871650-219871672 ATGGATGGCAATGTGGAATGTGG + Intergenic
948383692 2:237568428-237568450 ATGGATGGCCAAGAGGGCTGTGG - Intergenic
1174339399 20:49886629-49886651 ATTGATGGTCAAGTGGAGTTAGG + Intronic
1176700082 21:10036082-10036104 ATAACTAGCGAAGTGGAATGAGG + Intergenic
1177331327 21:19667470-19667492 ATATAAGGCCATCTGGAATGTGG - Intergenic
1177584802 21:23077021-23077043 ATATATGGCCAAAGGGAAGGAGG + Intergenic
1178751701 21:35310850-35310872 AATGATGACCAAATGGAATGTGG - Intronic
1180182326 21:46123509-46123531 ATGGATGGGCAAGTGGATGGGGG + Intronic
1182108033 22:27703319-27703341 AAAAATGGCAAAGTGGAAAGTGG + Intergenic
1182273992 22:29173028-29173050 AGAGAAGGCCATGTGGCATGGGG + Intergenic
1184469582 22:44688698-44688720 ATATATGGCCAGGTGCAGTGTGG + Intronic
1185155601 22:49191758-49191780 ATAGATGGCCCAGAGGCACGAGG + Intergenic
949255390 3:2039226-2039248 ATACATGGCCAAGTGAAAGAAGG - Intergenic
950142696 3:10626284-10626306 AGAGATGGCAAAGTGGAAAAAGG - Intronic
950188617 3:10960812-10960834 ATAGATGGGGTAGTGGAGTGTGG + Intergenic
954444023 3:50536980-50537002 ATGGCTGGCCACGTGGGATGTGG - Intergenic
955785134 3:62529622-62529644 ATGGATGGCCACATGGAATCAGG + Intronic
956206300 3:66758566-66758588 ATCAATGGCCAAGTGTTATGAGG + Intergenic
956573397 3:70723249-70723271 ATAGGTAGCCAGCTGGAATGTGG - Intergenic
957988483 3:87600873-87600895 ACAGAAAGCCAAGTGGAGTGAGG - Intergenic
959651937 3:108758592-108758614 ACATATGGCCAAGAGGAATGAGG + Intergenic
960499856 3:118423860-118423882 ATAAATGGCCAAGAGGTATATGG + Intergenic
961520510 3:127464968-127464990 AGAGCTGGCCAAGTGGGCTGGGG + Intergenic
964392353 3:156210957-156210979 AGAGTTGGCCAAATGCAATGTGG + Intronic
967451409 3:189627742-189627764 ATCGATTGCAAAGTGGTATGAGG + Intergenic
970602311 4:17650169-17650191 ATGGATGGACAAGTGGATGGGGG - Intronic
971822343 4:31574301-31574323 AGAGAAAGCCAAGTGAAATGAGG - Intergenic
972183207 4:36495391-36495413 GTAGATGTCCAAGTGGAAGCTGG - Intergenic
976627844 4:87206257-87206279 ATTGATGGCAAGGAGGAATGTGG - Intronic
977063661 4:92287428-92287450 AAAGAGGGCCAAGAGAAATGGGG + Intergenic
978855664 4:113391450-113391472 ATAGTTGGCCAAGAGGCATTTGG + Intergenic
978949930 4:114545776-114545798 AGAGATGGCAAGGTGGAAGGTGG + Intergenic
979041619 4:115805154-115805176 ATACATGGGCAAATGTAATGTGG - Intergenic
980372482 4:131894714-131894736 ATAACTAGCGAAGTGGAATGAGG + Intergenic
980437474 4:132796578-132796600 AGAGATGGCAGAGTGGAAGGTGG + Intergenic
981272757 4:142863889-142863911 ATAGAGGGAAAAGTGGCATGAGG - Intergenic
983289007 4:165777615-165777637 ATACATGGCAAAGGGGAATTAGG + Intergenic
992669137 5:79041336-79041358 ATAAATGGCCAAATAAAATGGGG + Intronic
992936805 5:81715767-81715789 ATAGATGGCCAGGTGCAGTGTGG + Intronic
993284426 5:85973248-85973270 ATAGATGGCACAATGGAGTGGGG + Intergenic
995558767 5:113358255-113358277 AGAGCTGGCCAAGTAGAATAGGG - Intronic
996093874 5:119377935-119377957 GTAGATGGCCAGGAGGGATGTGG + Intronic
996606370 5:125328347-125328369 ATAGATGGCCAGAAAGAATGGGG + Intergenic
997579339 5:135007507-135007529 ACAGAAGGCCGAGAGGAATGTGG - Intronic
999429185 5:151511330-151511352 ATAGATGGCTGAGAGGCATGTGG + Intronic
1000580095 5:163026024-163026046 CTAGATGCCCAAGTGGAAACTGG + Intergenic
1000855462 5:166392569-166392591 TCAGTTTGCCAAGTGGAATGAGG + Intergenic
1003525347 6:6892325-6892347 ATAGCTGCCCAAGTGCAGTGAGG - Intergenic
1003912290 6:10753385-10753407 CTAAATGGCCAAGTAAAATGAGG - Intronic
1006791109 6:36701859-36701881 ATGGTTTGACAAGTGGAATGTGG - Intronic
1007710728 6:43822354-43822376 CCAAAAGGCCAAGTGGAATGAGG + Intergenic
1009059188 6:58376756-58376778 ATGAATGGCCAAATGGAATATGG + Intergenic
1009231656 6:61070372-61070394 ATGAATGGCCAAATGGAATATGG - Intergenic
1013921598 6:115412006-115412028 ATAGATGGAAAAGGGAAATGTGG + Intergenic
1014353449 6:120373475-120373497 ATAGTTGTCCAAGTGGAAGGAGG - Intergenic
1014707696 6:124767782-124767804 ATAAATGGGCAAGTGCAGTGTGG - Intronic
1018373708 6:163191663-163191685 ACAGATGGCCACGTGGAGTGTGG - Intronic
1019935644 7:4255600-4255622 AGAGATGGCCAAGAGTACTGGGG - Intronic
1022071660 7:26922115-26922137 AAAGAAGGCCAAGGGGAATAAGG + Intronic
1023574978 7:41617892-41617914 AATGCTGGCCAAGAGGAATGGGG + Intergenic
1023586371 7:41734253-41734275 ACAGATGGCCAACTAGAATAAGG - Intergenic
1023862190 7:44223477-44223499 AGAGCTGGGCAGGTGGAATGGGG - Intronic
1024035343 7:45503377-45503399 GAAGATGACCCAGTGGAATGAGG + Intergenic
1028100083 7:86808557-86808579 ATAGCACGCCAAGTGGAATAAGG + Intronic
1031352029 7:120744762-120744784 AGAGATGGTTAAGTGGAATTTGG + Intronic
1033234170 7:139625097-139625119 ATAGATGGACGAGGGGCATGTGG - Intronic
1039369208 8:36967545-36967567 ATAGATGGAAAGGTGGAATTTGG - Intergenic
1040793322 8:51260040-51260062 ATACATGGCTTATTGGAATGCGG - Intergenic
1042254494 8:66789244-66789266 GTAAATGGCCAAGTTAAATGGGG + Intronic
1042744240 8:72088718-72088740 ATAGATGTCAAAGTGGTGTGTGG - Intronic
1043133186 8:76487735-76487757 ATAGGAGGACGAGTGGAATGAGG + Intergenic
1044547646 8:93477333-93477355 AGAGAGGGCCAAGGGGAGTGAGG - Intergenic
1044958844 8:97509627-97509649 ATATATGAGGAAGTGGAATGAGG + Intergenic
1047713610 8:127575778-127575800 TTATATAGCCAAGTGGAAGGTGG - Intergenic
1047737920 8:127782800-127782822 ATAAATGGCCAAGAATAATGGGG - Intergenic
1053120648 9:35545150-35545172 ATAGCTCGTCATGTGGAATGTGG - Intronic
1053637222 9:40022557-40022579 ATAACTAGCGAAGTGGAATGAGG + Intergenic
1053768805 9:41442364-41442386 ATAACTAGCGAAGTGGAATGAGG - Intergenic
1054318057 9:63619406-63619428 ATAACTAGCGAAGTGGAATGAGG + Intergenic
1054547472 9:66353841-66353863 ATAACTAGCGAAGTGGAATGAGG - Intergenic
1054852659 9:69864575-69864597 ATAAATGGGCAAGTTAAATGAGG + Intronic
1055160213 9:73117534-73117556 GTAGAGGGGCAAGTGGACTGAGG - Intergenic
1055922497 9:81475839-81475861 ATTGAAGGCCAAGTGAAATTTGG + Intergenic
1056376581 9:86019535-86019557 TTAAATGGTCAAGTGGAATAAGG - Intronic
1058007496 9:99933652-99933674 GTAGAAGGCCATGTGGGATGGGG - Intronic
1202785094 9_KI270719v1_random:6142-6164 ATAACTAGCGAAGTGGAATGAGG + Intergenic
1186950483 X:14619198-14619220 ATAGAAGGCAAAATGGAATCAGG - Intronic
1188102160 X:26102290-26102312 ATAGAGGGCCAAATGGAAGCTGG - Intergenic
1189526159 X:41824301-41824323 ATAGATTGATAAGTGGCATGAGG - Intronic
1192146253 X:68684794-68684816 AGAAATGGCCTAGTGGAAGGAGG + Intronic
1193713242 X:84903808-84903830 ATGGATGGAAAAGTGGAGTGAGG - Intergenic
1194644546 X:96442749-96442771 ATAGATGTCTAAGTGAAATCAGG - Intergenic
1195178882 X:102338203-102338225 ATAAATGTACAAGTGAAATGTGG - Intergenic
1195965834 X:110429409-110429431 ATAGATGGCAAAGAGAAGTGAGG - Intronic
1202083509 Y:21110363-21110385 ATAGGTTGCCAAGTGGAATTAGG + Intergenic