ID: 926794595

View in Genome Browser
Species Human (GRCh38)
Location 2:16608473-16608495
Sequence ATGGCCAAGTGGAATGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926794590_926794595 15 Left 926794590 2:16608435-16608457 CCCTCATCTATTTTAAGATCGCA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG 0: 1
1: 0
2: 2
3: 25
4: 294
926794591_926794595 14 Left 926794591 2:16608436-16608458 CCTCATCTATTTTAAGATCGCAA 0: 1
1: 0
2: 2
3: 12
4: 96
Right 926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG 0: 1
1: 0
2: 2
3: 25
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926794595 Original CRISPR ATGGCCAAGTGGAATGAGGA CGG Intronic
901001374 1:6150548-6150570 ATGGACAAATGGATTGATGATGG + Intronic
901347638 1:8560481-8560503 ATGGCCTACTGGAAAGAAGATGG + Intronic
901393380 1:8963030-8963052 ATGTCCAAGTGGTATGACGAGGG - Intronic
901861187 1:12075618-12075640 ATGGCAAAGGGGAATCAGGGTGG - Intronic
903116298 1:21181225-21181247 TTGGCTAAGGGGAGTGAGGACGG - Intergenic
906264865 1:44420995-44421017 ATGGCAATGTGGAAAGAGGGAGG + Intronic
906568849 1:46819512-46819534 GTGGCCAAGTGGCATTAGAAGGG + Intergenic
908066870 1:60415556-60415578 AAGGCCAAGTGGTGTGGGGAGGG - Intergenic
908331486 1:63074983-63075005 ATGGCCACGGGTATTGAGGATGG - Intergenic
908403488 1:63792039-63792061 AGGGCCAAGAAGAATGAGCAGGG + Intronic
908541395 1:65126034-65126056 CTGCCCAAGTTGACTGAGGAGGG + Intergenic
909432755 1:75608659-75608681 AAGACCAAGTGGAATTAGTAAGG - Intronic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
911183973 1:94885482-94885504 ATGGCTTAGTGGAAAGAGGCTGG - Intronic
911932911 1:103927641-103927663 ATTGCCAAGAGTAATGTGGAAGG + Intergenic
914326705 1:146624510-146624532 ATGGCCAGGTGAAATTGGGATGG - Intergenic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916501603 1:165392378-165392400 GTGGCCCAGTGGAAGGAGCAGGG - Intergenic
917657294 1:177138970-177138992 ATGGCGGAGTGGAAAGAGCATGG - Intronic
920316161 1:205076972-205076994 AGGGCCTCCTGGAATGAGGAAGG - Exonic
920827819 1:209438206-209438228 AGGGCAAAGTGGAATGATGTGGG - Intergenic
921747772 1:218756932-218756954 ATGGGGATGTGAAATGAGGATGG + Intergenic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1064533264 10:16331892-16331914 ATGGCAGAGTGGAGTGAGCAAGG + Intergenic
1065982973 10:30920565-30920587 ACTGCCAAGTAAAATGAGGATGG - Intronic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067157188 10:43792160-43792182 AAGGACAAGTGGCATAAGGAGGG - Intergenic
1067213503 10:44281390-44281412 AAAGCCAGGTGGAATGGGGAGGG + Intergenic
1067858322 10:49817440-49817462 AGGCCCCAGTGGAATGGGGATGG + Intergenic
1068198898 10:53757012-53757034 ATCCCCAAGTGGGATGAGGAGGG - Intergenic
1068226228 10:54110008-54110030 AAGTACAAGTGGAATGAAGAAGG + Intronic
1068559630 10:58499093-58499115 ATGGCAAAGTGCAGTGAGAAAGG - Intergenic
1068777863 10:60887615-60887637 AGGGCCAAGGAGCATGAGGACGG + Intronic
1069761174 10:70812631-70812653 ATTGCCAACTGGAGTGAGCAAGG - Intergenic
1069861880 10:71476562-71476584 TTGGCCAAGAGGACAGAGGATGG + Intronic
1070585951 10:77766271-77766293 AAGTCCAGGTGGAAAGAGGAAGG + Intergenic
1072770589 10:98134457-98134479 ATAGCCGAGAGGAATGAGGAAGG + Intergenic
1073322890 10:102626289-102626311 ATGGCCCAGCAGATTGAGGAAGG + Intronic
1073899372 10:108202274-108202296 ATGGCAAAGTGGAATCTGCAAGG + Intergenic
1074339934 10:112618599-112618621 TTGGCCTAGGGGAAGGAGGAAGG + Intronic
1075274775 10:121083658-121083680 ACAGCCAAGTGGCATGAGCAAGG + Intergenic
1075458440 10:122599994-122600016 TCGGCAAAGTGGAACGAGGAGGG - Intronic
1076109410 10:127849448-127849470 ACGGACAAGGGGCATGAGGAGGG + Intergenic
1076296025 10:129385515-129385537 TTGGACATGTGGAATGTGGATGG + Intergenic
1076781199 10:132725579-132725601 AGGGCCCAGTGGGATGAGGCCGG - Intronic
1077868532 11:6242298-6242320 ACAGCCAAGTGGAAAGAGAAAGG + Intronic
1077977087 11:7258590-7258612 ATGACAAAGTGGAATAAGCAAGG + Intronic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1079225598 11:18602107-18602129 CTGGTCTAGTGGAATGAGTATGG - Intergenic
1080941598 11:36924439-36924461 ATTAACAAGAGGAATGAGGAAGG + Intergenic
1081875203 11:46403833-46403855 AGGGCCAAGGGGAGTGGGGAGGG + Intronic
1082779335 11:57274297-57274319 TAGGCCAAGTGGAATGAGTGTGG - Intergenic
1083815095 11:65128222-65128244 TAGGCCAAGTGGAAAGAGGCTGG - Exonic
1084443851 11:69192011-69192033 GTGGCAAACTGGGATGAGGATGG + Intergenic
1084817005 11:71654023-71654045 ATGTGCAGGTGGAATGAAGAGGG + Intergenic
1085146090 11:74199028-74199050 ATAGCTAACTGGAATGAGGTGGG - Intronic
1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG + Intronic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1087528868 11:99353610-99353632 ATGGCTAAGTCAAAAGAGGAGGG + Intronic
1088653616 11:111978432-111978454 ATGGCCAAGTGGAGAGATAAAGG - Intronic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1090334193 11:125951768-125951790 ATGGCCCTGTGGAAGGAGGAAGG - Intergenic
1090726942 11:129536514-129536536 TAGGCACAGTGGAATGAGGAAGG - Intergenic
1091076268 11:132620511-132620533 AAGGCTAAGGGGAATCAGGAAGG + Intronic
1091221475 11:133932093-133932115 GTGGTCAAGTGGAACAAGGACGG - Exonic
1092425993 12:8376042-8376064 ATGTGCAGGTGGAATGAAGAGGG - Intergenic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094680193 12:32660703-32660725 AGGTCCAAGTGGAACGATGATGG + Intergenic
1096374435 12:51096524-51096546 GTGGCAAAGTGGAATGGCGAAGG + Intronic
1097247129 12:57612781-57612803 CTGGCCAACTCAAATGAGGATGG + Intronic
1103038219 12:117673445-117673467 ATGGACAGATGGAAAGAGGAAGG + Intronic
1103727516 12:123005401-123005423 ATGGCCCAGTTCAATGAGGATGG - Exonic
1104655645 12:130572133-130572155 ATGGCCAGGAGTTATGAGGAAGG + Intronic
1106405005 13:29465688-29465710 ATGGTCAAGTGGAACAAGCAGGG - Intronic
1107420124 13:40238354-40238376 AGCCCCAAGTGGAAGGAGGATGG - Intergenic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1108081868 13:46745474-46745496 ATAGCCAGGTGGAGTGGGGAGGG + Intronic
1109582714 13:64363563-64363585 ATGGCAGAGTGGATTGGGGAAGG - Intergenic
1111711746 13:91824464-91824486 ATGGCAAAGTGAAATGTGAAAGG + Intronic
1113433117 13:110267254-110267276 ATGACCCAGTGGAGGGAGGAGGG + Intronic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1113650108 13:112028499-112028521 ATGGCCCAGAGGAAGGAGGGAGG + Intergenic
1114190032 14:20433986-20434008 ATGGCCTAGTGGAAGGAGACTGG + Intronic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1115950924 14:38720323-38720345 ATGGCCATATGGGATGAAGAGGG - Intergenic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1117380470 14:55157103-55157125 ATTGGCAAATGGAATGAGAAGGG + Intronic
1122412957 14:101535246-101535268 GTGGCCAAGTGCAGTGGGGATGG - Intergenic
1122448826 14:101787350-101787372 TTTGCCAGGTGGAAGGAGGAAGG + Intronic
1124550933 15:30680735-30680757 ATCTCCAAGAGGAATGTGGATGG - Intronic
1124680320 15:31724934-31724956 ATCTCCAAGAGGAATGTGGATGG + Intronic
1125090401 15:35784264-35784286 AATGCCTAGTGGAAAGAGGATGG - Intergenic
1125336305 15:38629926-38629948 AAGGCCTAGTGGATTGGGGAGGG + Intergenic
1125413427 15:39428567-39428589 ATGGTGAAGTGGAATGATAATGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125499303 15:40228807-40228829 ACGGCCTTGTGGAATGAGAATGG - Intergenic
1126217433 15:46172399-46172421 GTGGCCTAGAGGACTGAGGAAGG + Intergenic
1128300830 15:66565456-66565478 AAGGCCAAGTGGGGAGAGGAAGG + Exonic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1128925454 15:71651209-71651231 ATGGCCAACTGGACTGAAGATGG - Intronic
1130646695 15:85734431-85734453 AGGGCCAGGTGGAATAAGGGAGG - Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1137030157 16:35516350-35516372 ATGGCCAAGAGGAATTTGAAAGG + Intergenic
1137351732 16:47719216-47719238 AGGGCCATGTGGAGTGAGGGAGG - Intergenic
1137945175 16:52726996-52727018 ATTGTCAAGTGGAATGCTGAAGG - Intergenic
1138200468 16:55084528-55084550 ATGGCAGAGTGGAACAAGGAAGG - Intergenic
1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG + Intronic
1139100272 16:63758134-63758156 CTGGCCATGTAGAATGAGGTTGG - Intergenic
1139648191 16:68347107-68347129 CTGGGCAAGTGGAGTGAGAAGGG + Intronic
1140006859 16:71086435-71086457 ATGGCCAGGTGAAATTGGGATGG + Intronic
1140135248 16:72199869-72199891 ATGGCAGCGTGGAATTAGGATGG + Intergenic
1140955914 16:79865142-79865164 ATGGGCAAGTTTAATGCGGAAGG - Intergenic
1140962590 16:79930901-79930923 AAGGCCAAGTGGATGGATGATGG - Intergenic
1141291900 16:82725738-82725760 AGAGCCAAAAGGAATGAGGATGG - Intronic
1141908304 16:87041853-87041875 AAGGAGAAGTGGAATTAGGAGGG - Intergenic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1145041829 17:19582785-19582807 ATGGCCAAGTGGATTAAGGACGG + Intergenic
1145042581 17:19587925-19587947 ATGGCCAAGTGGATTAAGGACGG - Intergenic
1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG + Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146646273 17:34579368-34579390 ATGGACACGTGGACAGAGGAGGG + Exonic
1146785493 17:35717236-35717258 ATTGCCAAGAGGAATGTGGAAGG + Exonic
1146978578 17:37138208-37138230 ATGGCCAATCTGAATGAGAAGGG + Intronic
1147301872 17:39535869-39535891 AGGGCTAAGTGGAATGGGAATGG + Intronic
1149374630 17:56031697-56031719 ATGGCTGAGTAAAATGAGGAAGG + Intergenic
1149663303 17:58347919-58347941 AGGGCCTAGTGCAAAGAGGAGGG + Intronic
1150739041 17:67764861-67764883 AAGCCCAAGAGGAATGAGGCAGG + Intergenic
1150739741 17:67769758-67769780 GTGGCCAAGTGGAATACTGAGGG - Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1152458416 17:80428951-80428973 CAGGCTAAGTGGACTGAGGAAGG - Intronic
1153626414 18:7025721-7025743 ATGACCAAGAGGAATCAAGAGGG + Intronic
1153734203 18:8047595-8047617 GTGACCAGGTGGAATGAGGGTGG + Intronic
1154254495 18:12770701-12770723 ATGGCCACGTGGTAGGAGAAAGG - Intergenic
1156332697 18:36139431-36139453 CTGGCCAGGTGGAACGAGGCAGG + Exonic
1156808674 18:41220888-41220910 ATGGCAGAATGGAATGAGGTGGG + Intergenic
1157703807 18:49783800-49783822 CTGGCCAAGTAGAGTAAGGATGG + Exonic
1158482044 18:57830745-57830767 AGGGCCACGTGGGATGAGGTTGG + Intergenic
1159037402 18:63290880-63290902 AGGGCCGAGTGGGATGAGGGTGG - Intronic
1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG + Intergenic
1162500786 19:11052469-11052491 ATGGCCAGGTGGAGGAAGGAGGG - Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1163415595 19:17184685-17184707 TGGGCCCAGTGGAATGAGGTGGG - Intronic
1164752225 19:30665501-30665523 ATGGCCCTGTGGGCTGAGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167095896 19:47375036-47375058 ACGACCAAGTGGAGAGAGGAGGG - Intronic
1167117694 19:47497729-47497751 ATGACCAAGTGTAACCAGGAAGG - Intronic
1167469788 19:49669207-49669229 ATGGTCAGGTGGAAAGAGGCTGG + Intronic
1167725934 19:51212486-51212508 ATGGCCATGGGGGCTGAGGATGG - Intergenic
1168286842 19:55339500-55339522 AGGTCCAAGTGGAAAGAGGGCGG - Intergenic
926481526 2:13402796-13402818 ATGATCAAGTGGAATTAAGATGG + Intergenic
926537894 2:14136054-14136076 ATGGTCAAGTTTAGTGAGGAAGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
928290685 2:30034572-30034594 ACGGCAAAGTGCCATGAGGATGG - Intergenic
930878413 2:56245391-56245413 GAGGCCATGTGGCATGAGGAGGG - Intronic
931926052 2:67073734-67073756 TTGGGCAGGTGGAAGGAGGAAGG - Intergenic
932627485 2:73309119-73309141 AGGGACAAGGGGCATGAGGAAGG - Intergenic
933426410 2:82118332-82118354 ATGGCAAACTGGAAGGAAGATGG + Intergenic
934779610 2:96961182-96961204 ATGACCCATTGAAATGAGGATGG + Intronic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935996989 2:108785248-108785270 GTGGCCGAGTGGAATGGTGATGG - Exonic
936491452 2:112976228-112976250 AGGACCAAGTGGAATGAGGGCGG + Intronic
936509431 2:113133195-113133217 ATGGGAAGGTGGAATGAGGGAGG - Exonic
938299582 2:130200652-130200674 ATGGCCAACAGGAAAGGGGAAGG + Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
940212199 2:151266389-151266411 ATGGCCATGTAGCTTGAGGAAGG + Intergenic
942672470 2:178390662-178390684 ATGGCCAAATTTTATGAGGAGGG - Intronic
945324504 2:208466617-208466639 AAGCCCAAGTGGAATGAGTTAGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
1169850034 20:10037992-10038014 ATGGTAAAGTGTGATGAGGAGGG + Intronic
1171030671 20:21673740-21673762 ATGACCAAGTGGGATGACAATGG + Intergenic
1173564813 20:44031123-44031145 GTGGCCAAGTGGTATGAAGGTGG + Intronic
1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG + Intronic
1173885762 20:46457636-46457658 ATGGCGAGCTGGACTGAGGATGG - Intergenic
1176700083 21:10036086-10036108 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1176885170 21:14246554-14246576 CAGGCCAAGTTGTATGAGGAGGG - Intergenic
1177744949 21:25200772-25200794 ATGGCCAAGTAGAAGGTTGAAGG - Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178072447 21:28983674-28983696 ATGGCTAATTGAAAGGAGGAAGG + Intronic
1178219923 21:30644696-30644718 ATGCCCATGTGGTATGAGAATGG + Intergenic
1178931060 21:36819781-36819803 ATGGGAAAGTGGAAAGAGTATGG - Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1181850072 22:25743583-25743605 AAGGCCAAGTGGGTGGAGGAGGG + Intronic
1181942823 22:26492002-26492024 ATGGCCAAGTGAACTGTGGCAGG - Exonic
1183592794 22:38790395-38790417 CTGCCCAAATGGAATGAGCATGG + Intronic
949285010 3:2392149-2392171 ATAGCCAAGTGGATTTGGGAAGG - Intronic
950031772 3:9858514-9858536 TTGGCTAAGTGGAAAGATGAAGG - Intergenic
950142695 3:10626280-10626302 ATGGCAAAGTGGAAAAAGGCCGG - Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950415520 3:12867039-12867061 TTGGCCAAGTGGACAGATGAAGG - Intronic
950417092 3:12875014-12875036 TTGGCCAAGTGGACAGATGAAGG - Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
953338793 3:42116761-42116783 ATGGCCAAGTGGAAAGTTGGTGG + Intronic
953477832 3:43221088-43221110 ATGGCCAAGTGCCAGGTGGAAGG + Intergenic
953531157 3:43740830-43740852 ATGGTTAAGTGGATTGATGATGG - Intergenic
954596513 3:51829934-51829956 AAGGCCCAGGAGAATGAGGAGGG + Intronic
956206302 3:66758570-66758592 ATGGCCAAGTGTTATGAGGTGGG + Intergenic
957661363 3:83158248-83158270 ATAGTCAAGTGGAATGATAAAGG - Intergenic
960722943 3:120642409-120642431 CTGGGCATGTGGAATGAGGAGGG + Intronic
961647813 3:128401730-128401752 ATAGCCAGGTGGGATGAGGGAGG + Intronic
961783818 3:129337513-129337535 TTGGCCAAGTGGACAGATGAAGG - Intergenic
964296441 3:155239471-155239493 ATGGCACATTAGAATGAGGATGG - Intergenic
964500997 3:157348018-157348040 GTGGCTAGGTGGAATGAAGATGG - Intronic
965447104 3:168788214-168788236 TTGGCCTAATGGAATGAGGTAGG - Intergenic
967132923 3:186489096-186489118 CTGGCTATGTGGGATGAGGAGGG - Intergenic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969741960 4:9035020-9035042 ATGGCCTCGTGGGATGAGAAAGG - Intergenic
970875374 4:20862957-20862979 GGGGCCTAGTGGAATGTGGAGGG + Intronic
971766523 4:30839264-30839286 ATAGCCAAAAGGAATGAGAAGGG + Intronic
973262306 4:48177541-48177563 ATGGCCCAGGTGAATGAGGCAGG - Intronic
975245281 4:72113403-72113425 ATGGCTAAATGGATTGATGAAGG - Intronic
976385725 4:84455695-84455717 AAGTCAAAGTGGAATGAGAAAGG + Intergenic
977488808 4:97685524-97685546 ATTGCCAAGTGGTCAGAGGAAGG + Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978927037 4:114259333-114259355 ATGGGTAAGTGCAATGATGAGGG + Intergenic
980372483 4:131894718-131894740 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
982546509 4:156739770-156739792 ATGGCCAAGTGAATTTAGAAAGG - Intergenic
983377222 4:166945631-166945653 GTGGTCAATTGGAGTGAGGAGGG - Intronic
983758207 4:171369138-171369160 ATGGTTAAGTGTAGTGAGGAAGG + Intergenic
984096406 4:175440496-175440518 ATTGCCCAGTTGAATGATGATGG + Intergenic
985901279 5:2796660-2796682 ATGGCCAAGTGTCATGATGTGGG - Intergenic
986252044 5:6068975-6068997 ATGTCCCATAGGAATGAGGATGG + Intergenic
988372655 5:30391547-30391569 CTTGCCAAATGGAATGAGGCAGG - Intergenic
988891648 5:35624062-35624084 ATCACCATGTGGAATGTGGATGG + Intronic
988981378 5:36572740-36572762 ATGGGCAGGTGGAATAGGGATGG - Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990670561 5:58124915-58124937 ATTGCAAAATGGAATGGGGAGGG + Intergenic
991630022 5:68647301-68647323 CTGGCCAAGTGGGCTGGGGATGG - Intergenic
992154412 5:73940704-73940726 ATGGCCAAGCCCAATGAGAAAGG - Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
993779096 5:92043204-92043226 AGGGACAAGTGGAATGAAGGAGG - Intergenic
994358916 5:98827819-98827841 ATGGCTCAGTGGTATGAGTAGGG + Intergenic
996471536 5:123866987-123867009 ATGGCAAAGTGGAATGTAGAAGG + Intergenic
997485625 5:134227749-134227771 AAGACCAAGTGGAATGAATAAGG + Intergenic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1001609130 5:172985738-172985760 AGGGCTAAGTGGAAACAGGATGG - Intronic
1002660440 5:180787900-180787922 AAGGCCAAGAGGCTTGAGGAGGG + Intergenic
1003700058 6:8453845-8453867 TTGGCAAAGGGGAATGGGGAGGG - Intergenic
1005695769 6:28351340-28351362 GAGCCCAAGTGGAATGAGGAGGG - Intronic
1006943463 6:37768238-37768260 AACGCCCAGTGGAATGAGGTTGG - Intergenic
1009193718 6:60660353-60660375 ATGGCCTCATGGAATGAGAAAGG + Intergenic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1013282082 6:108647996-108648018 AGAGCTAAGTGGAAAGAGGAGGG + Intronic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1015864254 6:137711713-137711735 ATGACCACGTGGAGTGAGCAGGG + Intergenic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017439323 6:154448646-154448668 ATGGCCAAGTAGTCTGAGCACGG - Intronic
1017804008 6:157927113-157927135 ATGGAAAACTGGAAAGAGGAAGG + Exonic
1018542889 6:164902128-164902150 ATGGCAAAGTGGAAAGAGGGTGG + Intergenic
1019102342 6:169641420-169641442 CTGGCCAACTGAAAAGAGGAGGG - Intronic
1021898160 7:25257069-25257091 AAGCCCAAGTGTCATGAGGATGG + Intergenic
1022576308 7:31500531-31500553 ATTGAAAAGTGGAATGTGGAAGG - Intergenic
1023528912 7:41133560-41133582 ATGGCCAAGTGCACAGAAGAAGG + Intergenic
1025620917 7:63169990-63170012 GTAGCCAAAAGGAATGAGGAGGG + Intergenic
1027514011 7:79118763-79118785 ATGGGCCAGTGGAATCAGGGAGG - Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1029601486 7:101566015-101566037 AAGGCCCAGTGGTATGAGAAGGG + Intergenic
1032704096 7:134407081-134407103 TTGGCCAAATGGAATAAGGGAGG + Intergenic
1034889543 7:154827744-154827766 GAGCCCAAGTGGAGTGAGGAGGG + Intronic
1035120929 7:156566234-156566256 ATGGCCAGGTGAAAGGTGGAAGG - Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1036529501 8:9570487-9570509 ATGGCCCAGTGGCATTAGGATGG + Intronic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1037751647 8:21686285-21686307 ATTGCCAAGTGGAATTGAGAGGG - Intergenic
1039239936 8:35545440-35545462 ATTGCCCTGTGGGATGAGGAAGG + Intronic
1040033758 8:42849136-42849158 ATGATCAAGTGTAGTGAGGAAGG - Intergenic
1041517821 8:58721195-58721217 ATGGCTTAGTGGAAGGAGCAAGG + Intergenic
1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG + Intergenic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1042927879 8:73985139-73985161 ATAGCAAAGTGGCATGAGGGAGG - Intergenic
1043800260 8:84600682-84600704 ATGACTGAGAGGAATGAGGAGGG + Intronic
1044547644 8:93477329-93477351 AGGGCCAAGGGGAGTGAGGTGGG - Intergenic
1045744913 8:105406966-105406988 ATAGAACAGTGGAATGAGGAAGG + Intronic
1046548547 8:115682919-115682941 ATGTTCCAGTGGAATGATGAGGG + Intronic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047799846 8:128297426-128297448 ATGGCCGAGGTGAATGAAGATGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048827151 8:138439392-138439414 ATGGTGTAGTGGAATGAGAATGG - Intronic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG + Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1052395638 9:27934809-27934831 ATGGCAGAGTGGAAAGAGGATGG + Intergenic
1053342451 9:37349119-37349141 AATGCCAAATTGAATGAGGAGGG + Intronic
1053637223 9:40022561-40022583 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1053768804 9:41442360-41442382 CTAGCGAAGTGGAATGAGGAAGG - Intergenic
1054318058 9:63619410-63619432 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1054547471 9:66353837-66353859 CTAGCGAAGTGGAATGAGGAAGG - Intergenic
1059754869 9:117283173-117283195 ATAGCGAAGTAGAATGAGCATGG - Intronic
1060475807 9:123985709-123985731 ATGACCCAGTGGAATGAACAAGG + Intergenic
1061035756 9:128113595-128113617 ATGGCCAGGGGGAATGAAGGAGG + Intergenic
1061783495 9:133009135-133009157 ATTGCCAAGTGAAAAAAGGAAGG + Intergenic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062217980 9:135399414-135399436 ATGGCCAGGGGGACTGAGGTTGG + Intergenic
1202785095 9_KI270719v1_random:6146-6168 CTAGCGAAGTGGAATGAGGAAGG + Intergenic
1186643975 X:11486721-11486743 AAGCCCAAGTGGCATGAAGAGGG + Intronic
1187151778 X:16687699-16687721 TGGGGCAAGTGGAATCAGGAAGG - Intronic
1187232222 X:17434160-17434182 GCTGCCAAGTGGAATGTGGATGG - Intronic
1190143679 X:47870972-47870994 ATGGGCAAATGGATTAAGGAAGG - Intronic
1190445627 X:50520967-50520989 ATGGCCAGGTAGAAGTAGGAAGG + Intergenic
1191899616 X:66027300-66027322 ATGGTCAAGGGCACTGAGGATGG - Intronic
1192794628 X:74416676-74416698 ATGGCTGAGTGGTATGAGAAAGG + Intergenic
1193302703 X:79909949-79909971 TTGGCCTAGTGGAATCAGGTAGG + Intergenic
1194383316 X:93222384-93222406 ATTGCCAAGAGGAATGTGGAAGG - Intergenic
1194552633 X:95320340-95320362 ATGGCTAAGTGGAATGCTGAGGG - Intergenic
1195013102 X:100752491-100752513 GAGCCCAAGTGGAATGAGAAGGG + Intergenic
1195026494 X:100882821-100882843 ATGGCAAAGGGGAATGAAGGTGG + Intergenic
1195289072 X:103414195-103414217 ATGGCGATGTGGCAGGAGGAGGG + Intergenic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196812673 X:119641128-119641150 AAGGGGAAGTGGAATGAGGGGGG + Intronic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198116929 X:133553228-133553250 TTGGCCAAGTCGAATTAAGAAGG + Intronic
1198478858 X:137022432-137022454 ATGGGAGATTGGAATGAGGAGGG + Intergenic
1199399345 X:147378196-147378218 AGGGCCAATGGGAATGAGTAGGG - Intergenic
1200206095 X:154317462-154317484 AGGGCCAAGTGGTAGGAGCATGG + Intronic