ID: 926794597

View in Genome Browser
Species Human (GRCh38)
Location 2:16608488-16608510
Sequence GAGGACGGCGTTTTGTAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926794590_926794597 30 Left 926794590 2:16608435-16608457 CCCTCATCTATTTTAAGATCGCA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 926794597 2:16608488-16608510 GAGGACGGCGTTTTGTAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 26
926794591_926794597 29 Left 926794591 2:16608436-16608458 CCTCATCTATTTTAAGATCGCAA 0: 1
1: 0
2: 2
3: 12
4: 96
Right 926794597 2:16608488-16608510 GAGGACGGCGTTTTGTAGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926794597 Original CRISPR GAGGACGGCGTTTTGTAGTG TGG Intronic
1082773549 11:57228240-57228262 GAGGAAGGACTTTTGTGGTGAGG - Intergenic
1091351887 11:134904356-134904378 GAGGACGGCGAGTTGTGCTGAGG - Intergenic
1092667294 12:10816728-10816750 GAGGAAGGAGTTTTATAGTTAGG - Intergenic
1101985639 12:109444432-109444454 GGGGATGCCGTTTTGCAGTGTGG + Exonic
1106421254 13:29588125-29588147 GGGGAAGGAGTTTTGCAGTGTGG - Intronic
1121092274 14:91190930-91190952 GAGGAGGACGGTTTGGAGTGGGG + Intronic
1122723995 14:103738753-103738775 GCAGACGGCGTTGTGCAGTGGGG + Exonic
1126969559 15:54095131-54095153 GTGGATGGTGTTCTGTAGTGAGG - Intronic
1134304308 16:13018543-13018565 GATGAAGGCGATTTGCAGTGGGG + Intronic
1139607772 16:68032236-68032258 GAGGACAGCCTCTTGTAGGGTGG - Intronic
1150576505 17:66435404-66435426 GCAGCCGGCGTTTTGTCGTGTGG + Intronic
1158627469 18:59083881-59083903 AAGGACATCATTTTGTAGTGAGG + Intergenic
1160084891 18:75767473-75767495 CAGGACAGCGTTTTGAAGTCAGG + Intergenic
1164820177 19:31243883-31243905 GAGGAGGGCGGTTTGCACTGTGG + Intergenic
926794597 2:16608488-16608510 GAGGACGGCGTTTTGTAGTGTGG + Intronic
930499154 2:52189592-52189614 GAGGACTGCTTTTTTTGGTGGGG + Intergenic
935386535 2:102505188-102505210 GGGGAGGGCGTTTTGTGGAGGGG + Intronic
948274868 2:236700588-236700610 GAGGACTGGGTTTTGGAATGGGG + Intergenic
1181235085 22:21443780-21443802 GAGTACTGCGTTTTGTACTGGGG + Intronic
949895249 3:8763492-8763514 GAGGAGGGAGTTTGGTAGAGTGG - Intronic
997365750 5:133324258-133324280 GAGGGAGGCGTTGTGTAATGTGG + Intronic
1002770142 6:283246-283268 GAGGAGGGGCCTTTGTAGTGAGG + Intergenic
1024657290 7:51461792-51461814 GGAGACCACGTTTTGTAGTGGGG + Intergenic
1028742685 7:94293894-94293916 GAGATCTGCATTTTGTAGTGGGG - Intergenic
1037770754 8:21798081-21798103 GCAGACTGCCTTTTGTAGTGGGG - Intronic
1041266698 8:56072530-56072552 GGGGACGGCGTTTTGCTCTGTGG - Intronic
1057491317 9:95522161-95522183 GAGGCCGGTTTCTTGTAGTGTGG + Intergenic
1189844127 X:45116110-45116132 GAGAATGGCATTTTTTAGTGTGG + Intergenic