ID: 926795790

View in Genome Browser
Species Human (GRCh38)
Location 2:16617819-16617841
Sequence CTTAAAGACAAGTTCAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 275}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926795782_926795790 25 Left 926795782 2:16617771-16617793 CCATGTGGGATTCAACAGCCCTC 0: 1
1: 0
2: 1
3: 12
4: 110
Right 926795790 2:16617819-16617841 CTTAAAGACAAGTTCAGAGATGG 0: 1
1: 0
2: 2
3: 21
4: 275
926795787_926795790 6 Left 926795787 2:16617790-16617812 CCTCAAGGACTCTTTTGGGAGTT 0: 1
1: 0
2: 0
3: 13
4: 134
Right 926795790 2:16617819-16617841 CTTAAAGACAAGTTCAGAGATGG 0: 1
1: 0
2: 2
3: 21
4: 275
926795786_926795790 7 Left 926795786 2:16617789-16617811 CCCTCAAGGACTCTTTTGGGAGT 0: 1
1: 0
2: 1
3: 10
4: 140
Right 926795790 2:16617819-16617841 CTTAAAGACAAGTTCAGAGATGG 0: 1
1: 0
2: 2
3: 21
4: 275
926795781_926795790 30 Left 926795781 2:16617766-16617788 CCAGGCCATGTGGGATTCAACAG 0: 1
1: 0
2: 1
3: 10
4: 122
Right 926795790 2:16617819-16617841 CTTAAAGACAAGTTCAGAGATGG 0: 1
1: 0
2: 2
3: 21
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926795790 Original CRISPR CTTAAAGACAAGTTCAGAGA TGG Intronic
901957344 1:12796131-12796153 ATTAAAGACAATTTGAGACAGGG + Exonic
901965362 1:12861914-12861936 ATTAAAGACAATTTGAGACAGGG + Intronic
901980754 1:13032265-13032287 ATTAAAGACAATTTGAGACAGGG + Exonic
902001336 1:13196666-13196688 ATTAAAGACAATTTGAGACAGGG - Exonic
902020572 1:13342371-13342393 ATTAAAGACAATTTGAGACAGGG - Exonic
903195832 1:21687496-21687518 CTTAAAGACACCTTTAGACATGG + Intronic
904402665 1:30267072-30267094 CCTAAAGACAGGGTCACAGACGG + Intergenic
906464608 1:46065600-46065622 CTTTAAGACAACTTCCTAGAAGG - Intronic
906764420 1:48414441-48414463 CTACAAGTCAAGTTCAGAGCTGG - Intronic
907375456 1:54034476-54034498 CTTTAAGACAAGTTCAGGCCAGG + Intronic
907480265 1:54740881-54740903 ATTAAAGCCAAGTTCAGACATGG + Intronic
907506590 1:54923518-54923540 CTTAAAGACAAGTTCTTGGCTGG + Intergenic
909215985 1:72889949-72889971 TTTATAGAAAAGTTCAGAAAGGG - Intergenic
909901078 1:81136274-81136296 CTTAATGACTACATCAGAGATGG - Intergenic
910867488 1:91801701-91801723 ATTAAAGAAAAGTTGGGAGAGGG + Intronic
912394092 1:109326347-109326369 CTTAAGTACAAGTTCTGAGCTGG - Intronic
912901551 1:113655934-113655956 TTAAAAGAAAAGTTAAGAGACGG - Intronic
914443142 1:147724213-147724235 ACCAAAGACAAGTTCAGGGAAGG + Intergenic
914446170 1:147752484-147752506 TTTAAAGACAAGTCCCAAGAAGG + Intergenic
917112468 1:171562974-171562996 GTGAAAGATAAGTTCAAAGAAGG + Intronic
921463541 1:215457949-215457971 CCTAATGACAAGTACAAAGAAGG + Intergenic
922058636 1:222066075-222066097 ATTAAAGACAAAGTCAGAGTTGG - Intergenic
924479039 1:244410741-244410763 ATTAAAGACAGGGTCAGAAAGGG + Intronic
1066383638 10:34922462-34922484 ATAGGAGACAAGTTCAGAGAGGG + Intergenic
1067991501 10:51218594-51218616 CATAAAAACAAGATCAGTGATGG + Intronic
1068165019 10:53319165-53319187 TTTAAAGCCAAGTACAGTGACGG + Intergenic
1068223121 10:54068395-54068417 TTTAAAGACACGTACAAAGATGG + Intronic
1068805384 10:61189340-61189362 CTTGAAAACAAGTTTAAAGAAGG + Intergenic
1070229629 10:74551002-74551024 CTTAAAAAATAGTTCAGAGCTGG - Intronic
1073864200 10:107783802-107783824 CTTAAAGACAGCTAGAGAGAAGG - Intergenic
1074043814 10:109818457-109818479 CTTAAAGCCATGTTCTGAGCTGG + Intergenic
1075473189 10:122709508-122709530 CTTAAAGAAAAGTGAGGAGAAGG + Intergenic
1075889640 10:125935973-125935995 CCTAATGACGAATTCAGAGAAGG - Intronic
1079571105 11:21944269-21944291 CTTAAATGCCATTTCAGAGAAGG + Intergenic
1079586514 11:22131733-22131755 ATTAAAGACAGCTACAGAGAAGG + Intergenic
1080045145 11:27800334-27800356 CTAAAAGACAAGTTAAGGAAAGG + Intergenic
1085438654 11:76536191-76536213 ATTATAGACAAGTCCAGAGGGGG - Intronic
1086621571 11:88892432-88892454 CTTCAAGCCAAGTTCAGCAATGG - Intronic
1089047274 11:115513123-115513145 TTTAAAGACAATTTTAGTGAAGG - Intergenic
1089082957 11:115792595-115792617 CTCAATGACAAGTACAGAGTGGG + Intergenic
1090045223 11:123325915-123325937 CCAAAAGAAAAGTTCTGAGAAGG - Intergenic
1090080028 11:123606160-123606182 TTTAAAGATAACCTCAGAGATGG - Intronic
1090759685 11:129825518-129825540 CTTAGAGACAAGGCCAGAGCTGG + Intronic
1090890551 11:130919005-130919027 CCTAAAGAGAAGCTCAGTGATGG + Intergenic
1091439636 12:502500-502522 CTGAGAGACATGTTAAGAGACGG + Intronic
1092330753 12:7584620-7584642 CTTAAAGACAGCTAGAGAGAAGG + Intergenic
1094541277 12:31365044-31365066 CTTAAAGAAATGGTGAGAGATGG + Intergenic
1096428013 12:51520701-51520723 CTTCAAGACAGGGACAGAGAGGG + Intergenic
1096646705 12:53042296-53042318 CTGAATGAAAACTTCAGAGATGG - Intergenic
1098812157 12:75108543-75108565 TTTAAAAACAAGTTCAGAATTGG + Intronic
1099141018 12:78975320-78975342 CTGCAGGACGAGTTCAGAGAAGG + Intronic
1101422099 12:104558328-104558350 CATAAAGACAGGTACAGAGAAGG - Intronic
1101515989 12:105435698-105435720 GTTAAGGACAATTTCAGTGAGGG - Intergenic
1104177214 12:126344469-126344491 ATAATAGACAAGTTCAGAAAAGG - Intergenic
1105664937 13:22543552-22543574 CTTTAAGAATAGTTCAGAGAAGG - Intergenic
1105767597 13:23577476-23577498 GTTAAAAACACTTTCAGAGAAGG - Intronic
1106588727 13:31079821-31079843 CTCCAAGACAGGTTCAGAGAGGG + Intergenic
1107258270 13:38457143-38457165 CTTAAAGAAGAGCTCAGAAAGGG - Intergenic
1108105707 13:47006437-47006459 CTTAAAAACAATTTAAGACAAGG - Intergenic
1108535389 13:51371298-51371320 CATCCAGACAAATTCAGAGATGG + Intronic
1108597053 13:51958545-51958567 CTGAAAGACAAGGACAGTGAAGG + Intronic
1111064707 13:83074635-83074657 CTTAGAGACAACTAGAGAGAAGG + Intergenic
1111121660 13:83859520-83859542 ATTAAAAACAAGTCCAGAGAGGG - Intergenic
1113005576 13:105698285-105698307 CTTAAATACAACTTCAGTGTAGG + Intergenic
1113028130 13:105963785-105963807 CTTGAAGAAAAGTTGAGAGTTGG - Intergenic
1113511422 13:110857749-110857771 CATAAAGACAAGTACAGGAAAGG - Intergenic
1114792825 14:25679167-25679189 CCTAATGTCAAGGTCAGAGAAGG - Intergenic
1115465309 14:33708467-33708489 CTTAAAAACTAGTTAAGAGATGG + Intronic
1116329874 14:43582202-43582224 TTTAAAGCCAAGTTCAGCCATGG - Intergenic
1116580288 14:46632267-46632289 CTTAAATAAAAATTCAGAGGTGG + Intergenic
1117442172 14:55770284-55770306 TTTAGAGAAGAGTTCAGAGATGG + Intergenic
1118107561 14:62677173-62677195 CTAAATGTCAAGATCAGAGATGG - Intergenic
1118207095 14:63732680-63732702 AATAAAGTCAAGTACAGAGAAGG - Intergenic
1118998151 14:70856198-70856220 CTTAAAGATTAGTTTTGAGAAGG - Intergenic
1119878806 14:78083165-78083187 CTTAAAGACATGTTCAGCAAAGG - Intergenic
1122006832 14:98712223-98712245 CTTAAAGCCATCTTGAGAGATGG - Intronic
1122144154 14:99679193-99679215 CTGGGACACAAGTTCAGAGAAGG + Exonic
1124579665 15:30942330-30942352 CTTAAGGATAAGTTCTAAGACGG + Exonic
1125020160 15:34976641-34976663 AGTGAAGACAAGTTTAGAGAGGG + Intergenic
1125238237 15:37541551-37541573 CTTAAAGACAGCTAGAGAGAAGG + Intergenic
1125482933 15:40092994-40093016 GTTAAAGACAGTTTAAGAGAAGG - Intronic
1125997666 15:44179538-44179560 CTCAAAGACCAGATCATAGATGG + Intronic
1126014856 15:44340763-44340785 TTTAAAGAAATGTTCAGAGCAGG + Intronic
1126821098 15:52504950-52504972 CTTAACAAGAAGTCCAGAGAAGG + Intronic
1127879317 15:63142514-63142536 TTAAAAGAAACGTTCAGAGAAGG + Intronic
1129583139 15:76833109-76833131 CTTAAAGGCAGCTACAGAGAAGG + Intronic
1130406792 15:83609795-83609817 CTTAAAGTCAGGGTTAGAGATGG + Intronic
1130802885 15:87284760-87284782 CTTAAAAACAAGTACAAAGCTGG + Intergenic
1131812875 15:96190917-96190939 CTTAACAACCAGTTCAAAGATGG + Intergenic
1132539455 16:501716-501738 TTCACAGACAAGTTCGGAGAAGG + Intronic
1133948374 16:10368583-10368605 CTTTGAGACAAGTACAGAAAGGG - Intronic
1134504571 16:14794539-14794561 CTAAAAGAGAAGTTTGGAGAAGG + Intronic
1134576000 16:15334370-15334392 CTAAAAGAGAAGTTTGGAGAAGG - Intergenic
1134726443 16:16422131-16422153 CTAAAAGAGAAGTTTGGAGAAGG + Intergenic
1134940988 16:18289728-18289750 CTAAAAGAGAAGTTTGGAGAAGG - Intergenic
1137310311 16:47250023-47250045 CTTAAAGACATTTTCAGAGAAGG - Intronic
1138593207 16:58014462-58014484 CTTAAAGAAAGGTTCAGATTTGG - Intronic
1139272872 16:65699950-65699972 CTTAAAGAGAAGGACAGAGGGGG - Intergenic
1139868072 16:70079574-70079596 CTTAAAAAGGAGTTCATAGATGG + Intergenic
1140088293 16:71815909-71815931 CTAGAAGACAAATCCAGAGATGG - Intergenic
1140387266 16:74552279-74552301 CTTAAAAAGGAGTTCATAGATGG - Intronic
1140631697 16:76861144-76861166 CATAAAGATAATTTCATAGAAGG + Intergenic
1141017085 16:80460849-80460871 ATTAGAGATAAGGTCAGAGAAGG + Intergenic
1143401669 17:6649570-6649592 GTAAAAGACAAGGTCAGAAAAGG + Intronic
1143989636 17:10945676-10945698 CATAATGACTGGTTCAGAGAGGG + Intergenic
1144137610 17:12313387-12313409 GTTAAAGACAACTAGAGAGAAGG - Intergenic
1145021738 17:19437071-19437093 CTTAAAGACAATTTTAGAGATGG - Intergenic
1147630716 17:41929453-41929475 GTTAGAGACATGTTCATAGAGGG - Intronic
1149665437 17:58361900-58361922 TTTAAAAGCAAGTCCAGAGAAGG - Intronic
1153132657 18:1874710-1874732 CTGAGATATAAGTTCAGAGAAGG + Intergenic
1154406206 18:14093757-14093779 GTTAAAGCCATGTTCAGATAAGG - Intronic
1155217680 18:23657707-23657729 CTTAAAAACATATTCAGTGAAGG - Intronic
1156883117 18:42104066-42104088 CTCAAAGGCAAGTTCTGAGCTGG - Intergenic
1157053788 18:44200306-44200328 CTTAAAGACAGCTGGAGAGAAGG + Intergenic
1157264678 18:46208030-46208052 CATAAATACAAGTGCAGAGAAGG - Intronic
1158758491 18:60355576-60355598 TTTAAAAACATGTTTAGAGATGG + Intergenic
1158864315 18:61623230-61623252 TTTAAAGCCAAGCTCAGACATGG - Intergenic
1159615395 18:70573732-70573754 CTTAGAGACGATTTCAGAGGTGG - Intergenic
1162243503 19:9378808-9378830 CTTTAAGGCAAATTAAGAGAAGG + Intronic
1164542670 19:29132571-29132593 TTTAAAGGCAACTTCAGAGTGGG - Intergenic
1167702976 19:51061374-51061396 CTTAAAGAAGAGTTCAGGGCTGG - Intronic
926542012 2:14192776-14192798 CTGACAGACAAATTCAGATATGG - Intergenic
926795790 2:16617819-16617841 CTTAAAGACAAGTTCAGAGATGG + Intronic
930476193 2:51885572-51885594 TTTGAAGACAAGTTCCGTGAAGG - Intergenic
933217988 2:79652547-79652569 AGGAAAGACAATTTCAGAGATGG - Intronic
936071848 2:109376321-109376343 CTTAAAGACAGCTTCCAAGAGGG - Intronic
936678695 2:114745745-114745767 TTTAAATACAAATCCAGAGAAGG + Intronic
936975515 2:118217571-118217593 GTTCAAGATAAATTCAGAGAGGG - Intergenic
939112983 2:138030132-138030154 TTTAAATACAAGGTCAGGGAAGG - Intergenic
940200959 2:151150223-151150245 TTTAAAGACAAATACAGAAAAGG - Intergenic
940440593 2:153711511-153711533 ATTAAATGGAAGTTCAGAGAAGG + Intergenic
940879192 2:158929469-158929491 CTTAAAGTCCAGCTCAGAGGTGG + Intergenic
940949030 2:159651233-159651255 CTTAAAAACAAGTAATGAGATGG + Intergenic
941542393 2:166803008-166803030 GTTAAAAACAAGGTAAGAGAAGG + Intergenic
942308653 2:174633557-174633579 CTCAAATCCAAGTTAAGAGAAGG - Intronic
943975997 2:194478439-194478461 CTTAAAGAGAATTCCTGAGAAGG + Intergenic
946806699 2:223477631-223477653 GTTAAATATATGTTCAGAGAAGG + Intergenic
947055324 2:226093358-226093380 CTTAAAGGCAGCTTGAGAGAAGG + Intergenic
948841473 2:240651972-240651994 CTAAAACAAAAGTTAAGAGAGGG + Intergenic
1169237966 20:3947422-3947444 CTTAAAGACAAAATCAGTGAAGG + Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1173646890 20:44638979-44639001 ATTAAATAGAGGTTCAGAGAAGG + Intronic
1174271607 20:49373524-49373546 CTTAAAGTCAACTTCATGGAGGG - Exonic
1174511129 20:51053617-51053639 CATGGAGACAAGTCCAGAGACGG - Intergenic
1174916503 20:54659587-54659609 ATAAAACACAAGTTCAAAGAAGG - Intergenic
1177355518 21:20001344-20001366 CTTAAAAATAGGTTCAAAGATGG - Intergenic
1177752631 21:25304369-25304391 CTCAAAGAAAAATACAGAGAAGG + Intergenic
1177920890 21:27151013-27151035 ATTAGAGACAAGATCAGGGAGGG - Intergenic
1178060612 21:28850096-28850118 GTTAAAGACAGCTACAGAGAAGG + Intergenic
1182678037 22:32055466-32055488 ATTAAAGACAAGTTCCTAGAAGG + Intronic
1182760243 22:32716816-32716838 TTTAAAAAAAAGGTCAGAGAGGG - Intronic
1183195847 22:36352817-36352839 CTTAATGAAAAGTTCTGGGAGGG - Intronic
1185126842 22:49015874-49015896 CTGAAAGTCCAGTTCAAAGAGGG - Intergenic
1185135000 22:49064839-49064861 CTTATGGACATGGTCAGAGAAGG + Intergenic
949825107 3:8156885-8156907 CCGGAAGACAGGTTCAGAGATGG + Intergenic
951912540 3:27766834-27766856 CTTAAAGAAAACTTGAAAGAAGG - Intergenic
953384440 3:42498589-42498611 CTCAAGGACAAGTTCTGAAATGG - Intronic
953663222 3:44906041-44906063 CTTATAGATAAGGCCAGAGAGGG + Intronic
953829090 3:46279985-46280007 CATAAAGACAAGATCGGAGAGGG + Intergenic
954034198 3:47841798-47841820 CCTAAAGGCAGGTTTAGAGAGGG + Intronic
954050758 3:47974933-47974955 CCTAAAAGCAAGCTCAGAGAAGG + Intronic
954294606 3:49667232-49667254 CTTTACGGCAATTTCAGAGATGG + Intronic
954931292 3:54284738-54284760 CTTAAAATCAGGATCAGAGACGG + Intronic
955755815 3:62224107-62224129 CTTAAAGTCAATTCCAGAGGAGG + Intronic
956003854 3:64758411-64758433 CATAAAGACTAGTTTAGGGATGG + Intergenic
957239427 3:77639144-77639166 CTTAATGTCCTGTTCAGAGAAGG + Intronic
957592851 3:82223643-82223665 CTTAAAGGCAGCTACAGAGAAGG - Intergenic
957710794 3:83856905-83856927 CTTTAAGACATGTTCATTGATGG + Intergenic
958460403 3:94387201-94387223 ATTAAAGACAGCTTGAGAGAAGG + Intergenic
958526797 3:95271069-95271091 CATAATGACAACTTGAGAGACGG + Intergenic
958570275 3:95872667-95872689 ATTAAACACATGTTCAGAAAAGG - Intergenic
959515995 3:107267828-107267850 CTTAATACCCAGTTCAGAGAAGG + Intergenic
963255351 3:143139516-143139538 CTGTAAGACAAGTTCAAGGAGGG + Intergenic
963368785 3:144370665-144370687 CTTAAAGACAGCTAGAGAGAAGG + Intergenic
963532738 3:146491255-146491277 CTTAAAGGCAACTAGAGAGAAGG - Intronic
965487985 3:169302178-169302200 CTTCAAGACAAGTAGAGAAAAGG + Intronic
966111784 3:176411654-176411676 CTTAAAGAAAAGTTCAAGAAGGG - Intergenic
966239642 3:177742256-177742278 TTCAAAGGCAAGTTCAGATAGGG + Intergenic
968011176 3:195278120-195278142 CTTTAAGACATTTTCAAAGATGG + Exonic
969727971 4:8935949-8935971 CTTATAGACAAATTCAGTGAAGG + Intergenic
970149561 4:13074707-13074729 TTTTAAGGCAAGTGCAGAGAAGG - Intergenic
970698272 4:18703955-18703977 CCTAAAGAAAAATTCAGTGAAGG + Intergenic
970722242 4:19001391-19001413 TTTCAAGACAAGTTGAGAGAAGG + Intergenic
971879558 4:32352583-32352605 CCTAAAGACAAGATAAGACATGG + Intergenic
972571865 4:40318437-40318459 CTGAACCAGAAGTTCAGAGAAGG - Intergenic
972921992 4:43955022-43955044 CTGGAAGACAAGGACAGAGAAGG + Intergenic
972999828 4:44932813-44932835 TTTAAAGACAAGGACAGAAAAGG - Intergenic
973232014 4:47850930-47850952 CTTAAAGTCAAGTTAGTAGATGG + Intronic
974056022 4:56983675-56983697 TTTAAAGAAAATTTTAGAGACGG + Intronic
974128127 4:57720318-57720340 CTTAAAGAATATTTCAGAAATGG - Intergenic
974388955 4:61239601-61239623 CTTAAATACAAACACAGAGAAGG + Intronic
975896906 4:79104249-79104271 ATTAAAAACAACTACAGAGAAGG - Intergenic
976302050 4:83524619-83524641 GGTAAAGACAAGTTATGAGAGGG - Intergenic
976378897 4:84377091-84377113 GTTAAAGACCATGTCAGAGAAGG - Intergenic
978080457 4:104583860-104583882 GGTAAAGAAAATTTCAGAGAGGG - Intergenic
978940664 4:114432663-114432685 GTTAAAGGCAAGTGGAGAGAAGG - Intergenic
979113602 4:116791775-116791797 CTTAATGACCAATTCAGAGTTGG - Intergenic
980197091 4:129603316-129603338 TTTAAAAGCAAGTTCACAGATGG - Intergenic
982414694 4:155115829-155115851 ATTAAAGACAAAATCATAGAAGG + Intergenic
982736850 4:159015985-159016007 CTGAAAAAGAAATTCAGAGAAGG + Intronic
982771131 4:159398552-159398574 CCTCCAGAGAAGTTCAGAGAGGG + Intergenic
983151642 4:164289993-164290015 TTTAAAAACAATTTCAGAGAAGG - Intronic
983474579 4:168197929-168197951 CTTAAAGGCAGCTACAGAGAAGG + Intergenic
983649895 4:170026960-170026982 CTTAAAGCAAAGTCCACAGATGG + Intronic
984176312 4:176422553-176422575 CTTAATGAAAAGTCCAGAAAAGG + Intergenic
984237283 4:177175277-177175299 CTAAAAGAAAACTTAAGAGACGG + Intergenic
984839493 4:184054904-184054926 ATCAAACACAAGTTCAGACAAGG - Intergenic
985309730 4:188584344-188584366 CTAAAAGAAAAGTCCAGAGTTGG + Intergenic
987619929 5:20327780-20327802 CTTAGAGAAAAGTTCTGGGAGGG + Intronic
987620646 5:20335496-20335518 CTTAAAGAAAAGTTTTGGGAGGG - Intronic
987933087 5:24427640-24427662 CTTGAAGCCAAGTGCAGAAAGGG - Intergenic
989375258 5:40754351-40754373 CATACAGGCAAGTTCAGGGATGG + Intronic
989746097 5:44831937-44831959 CTTGCAGAGAAGCTCAGAGATGG - Intergenic
989751971 5:44905896-44905918 CTTTAAGAAAAGTTTAGAGGAGG - Intergenic
989788165 5:45357238-45357260 AATAAAGACAATTTCAGACATGG - Intronic
991276676 5:64856422-64856444 CTTAAAGACAAATACAGAAGTGG - Intronic
991708473 5:69383285-69383307 ATTAAAGAAGAGTCCAGAGAAGG - Intronic
992563134 5:77972499-77972521 GTTAAAGACGAGTTCACAGATGG + Intergenic
992862514 5:80926537-80926559 CATTAAGACAAGTTCATATAAGG + Intergenic
993819627 5:92598856-92598878 CATAAAAACCAGTTCAGATATGG + Intergenic
995074983 5:107972006-107972028 TTCAAATACATGTTCAGAGAGGG - Intronic
996215815 5:120864085-120864107 CAGAAAACCAAGTTCAGAGAAGG - Intergenic
996949758 5:129111335-129111357 CTTAATGACCAGTACAGAAAAGG - Intronic
997098400 5:130940020-130940042 TTTGAAGACAAGTTCTGAGATGG + Intergenic
997351622 5:133235181-133235203 CTTAAAGACACTTTCTGAGCCGG + Intronic
997781594 5:136664835-136664857 CTGAGCGACAAGGTCAGAGAAGG - Intergenic
1002785227 6:394833-394855 TTTAAAGGAAAGTTCCGAGAAGG + Exonic
1004885043 6:20042996-20043018 CTTTAACACAAGTTGTGAGAAGG + Intergenic
1005067342 6:21831437-21831459 TTTAAAGACAAGTTGTGGGAAGG + Intergenic
1006272333 6:32973855-32973877 CTTAAAAACAAATTCAGACAAGG - Intronic
1007912117 6:45526200-45526222 CTTAAAGACAGGTTCAGCTGTGG - Intronic
1009367431 6:62866418-62866440 ATTAAAGACAATATCAGGGAGGG + Intergenic
1009940145 6:70281242-70281264 CTTAAAGGCAGGATCAGACATGG - Intronic
1009969631 6:70613288-70613310 ATTAAAGCAAATTTCAGAGATGG + Intergenic
1010480704 6:76349562-76349584 CTCAAAAAGAAGCTCAGAGAGGG - Intergenic
1010716046 6:79231888-79231910 ATTAAACACAAGTTCCAAGAGGG + Intronic
1012293507 6:97490219-97490241 CTTAAACATAAGCTCAGTGAAGG + Intergenic
1012332846 6:98015224-98015246 CTGAAAGACAGGCTCACAGATGG + Intergenic
1012669212 6:102019191-102019213 GTTAAAGACTAGTTTTGAGATGG - Intronic
1013275379 6:108579874-108579896 CTTAAGGAAATGTTCAAAGAGGG - Intronic
1014453848 6:121614399-121614421 GGTAAGGATAAGTTCAGAGAAGG + Intergenic
1014969698 6:127799277-127799299 CAAAAAGACTAGTTAAGAGATGG + Intronic
1017613459 6:156216312-156216334 TTTAGAGACAAATTCACAGAAGG - Intergenic
1018307080 6:162469222-162469244 CTATAAGAAAAGTTCAGAGGAGG + Intronic
1023387059 7:39669223-39669245 CTTAAAATCAAGTACAGAGATGG - Intronic
1024279505 7:47707951-47707973 GTTAAAGAAAAGTAGAGAGAAGG + Intronic
1025425308 7:59982059-59982081 CTTGAAGACAATTGCAGAAAAGG + Intergenic
1028540999 7:91941665-91941687 CCTAAAGCCAAGTTCACAGCTGG - Intronic
1031374006 7:121002441-121002463 CTTAAAGATAATAACAGAGAGGG - Intronic
1033294450 7:140118365-140118387 TATAAAGACAAGTTCAAAAAAGG + Intronic
1034553231 7:151834177-151834199 CTTAAGGACAAATTCAAACAAGG + Intronic
1036968506 8:13327850-13327872 TACAAAGAAAAGTTCAGAGAGGG + Intronic
1038323840 8:26555210-26555232 GTTAAATACAAGTGCTGAGAAGG - Intronic
1039801313 8:40957907-40957929 ATTAAAGATAAGTTCTGACAAGG - Intergenic
1039807836 8:41017257-41017279 ATTGCACACAAGTTCAGAGATGG + Intergenic
1041405728 8:57497269-57497291 CTTGAAGACATGTTCAGAAAGGG + Intergenic
1042364287 8:67918694-67918716 CTTAAACTCTATTTCAGAGATGG + Intergenic
1042685300 8:71432084-71432106 TATAAAAAGAAGTTCAGAGAAGG - Intronic
1043414964 8:80038236-80038258 CTTAAAAAAAAGTTCAAAAAAGG + Intronic
1043561960 8:81503413-81503435 CTTGAGGACAATTTCACAGAGGG - Intergenic
1043967571 8:86495887-86495909 CTTAAAGACAGCTAGAGAGAAGG + Intronic
1045809932 8:106209579-106209601 ATGAAAGACAAGTACACAGAAGG - Intergenic
1045970050 8:108069846-108069868 CTTAAAAACCCGTTCAGACAAGG - Intronic
1046092839 8:109523747-109523769 CTTAAGGAGGAGTTCAGAGTTGG + Intronic
1046152011 8:110239866-110239888 CATAATGACTAGTTCACAGATGG - Intergenic
1046804665 8:118466694-118466716 CTTAAAGATAAGACGAGAGAAGG + Intronic
1047488335 8:125353289-125353311 CTTAAACACACGATCAGAAATGG + Intronic
1049995715 9:1032049-1032071 CTGAGACAGAAGTTCAGAGAAGG - Intergenic
1050014563 9:1220132-1220154 ATTATAGACAGGTTCAGACATGG + Intergenic
1050303914 9:4286989-4287011 CTTAAAGTGAAAATCAGAGATGG - Intronic
1051189627 9:14497910-14497932 AGAAAAGTCAAGTTCAGAGATGG + Intergenic
1052013764 9:23441982-23442004 CATGAAGACAAGAGCAGAGATGG + Intergenic
1052277749 9:26697018-26697040 CTTAAAGACAGGTAGAGAAAAGG + Intergenic
1053510003 9:38679638-38679660 CTTAAAAACTATTTCAGAGTAGG - Intergenic
1054895432 9:70304864-70304886 CTTCAAGAGAACTTCACAGATGG - Intronic
1055105215 9:72505008-72505030 CTTTAAAACATGTCCAGAGAGGG - Intergenic
1055549276 9:77415573-77415595 CTTACACACAATTCCAGAGAGGG - Intronic
1056139292 9:83658987-83659009 CTTAAAGAATAGTTAAAAGATGG + Intergenic
1059979744 9:119758513-119758535 CTTAAGGACAAGATCAGGGAGGG + Intergenic
1062458668 9:136653613-136653635 CTTACAGCCAAATTGAGAGAAGG - Intergenic
1185652426 X:1658045-1658067 CTTAAAGACAAATTCATCAACGG + Intergenic
1185852538 X:3502522-3502544 ATCAAAGACATGTTCAGACATGG + Intergenic
1186353922 X:8769961-8769983 CTTAAAGCCAAGTCCAGCCATGG + Intergenic
1188661871 X:32770268-32770290 CTGGAAGACAAGCTAAGAGAGGG + Intronic
1188703049 X:33289006-33289028 TTTATAGACAAGGTCAGACAAGG + Intronic
1191654261 X:63578684-63578706 GTTAAAGACAACTAGAGAGAAGG + Intergenic
1191662710 X:63667507-63667529 CTTCAAGGCAAGGTTAGAGATGG + Intronic
1192691542 X:73370583-73370605 CTTAAAGGCAGGTAGAGAGAAGG - Intergenic
1192918322 X:75678113-75678135 CTTAAAGACAGCTAGAGAGAAGG + Intergenic
1193174662 X:78378232-78378254 CTTAAAAACATGGTCAAAGATGG - Intergenic
1193263993 X:79445924-79445946 CTAAAAGAAAAGTTTAGAAAAGG + Intergenic
1193420154 X:81272881-81272903 CTCAAAGAGAAATTCAGATACGG - Intronic
1195989255 X:110666393-110666415 CTTAAAGAAGAGTTAGGAGATGG - Intergenic
1196586970 X:117441135-117441157 GTTAAAGGCAACTACAGAGAAGG + Intergenic
1197095244 X:122586610-122586632 CTTAGAGACAAAGACAGAGATGG + Intergenic
1197981703 X:132224060-132224082 ATGAAAGAGAAGCTCAGAGAAGG - Intergenic
1199658963 X:150027850-150027872 CTTATATAAAAGTACAGAGATGG - Intergenic
1200106604 X:153717058-153717080 TTTAAAGAGAATTTCAGAGATGG - Intronic
1201925274 Y:19278389-19278411 CTAAATTACAGGTTCAGAGAGGG + Intergenic