ID: 926796475

View in Genome Browser
Species Human (GRCh38)
Location 2:16623523-16623545
Sequence CAGTAGGAGGAGAGGTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926796475_926796481 2 Left 926796475 2:16623523-16623545 CCAAAGGACCTCTCCTCCTACTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 926796481 2:16623548-16623570 TAAATCTAGTTGGCTAGCATGGG 0: 1
1: 0
2: 1
3: 5
4: 74
926796475_926796478 -8 Left 926796475 2:16623523-16623545 CCAAAGGACCTCTCCTCCTACTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 926796478 2:16623538-16623560 TCCTACTGTCTAAATCTAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 115
926796475_926796480 1 Left 926796475 2:16623523-16623545 CCAAAGGACCTCTCCTCCTACTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 926796480 2:16623547-16623569 CTAAATCTAGTTGGCTAGCATGG 0: 1
1: 0
2: 1
3: 3
4: 87
926796475_926796482 10 Left 926796475 2:16623523-16623545 CCAAAGGACCTCTCCTCCTACTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 926796482 2:16623556-16623578 GTTGGCTAGCATGGGCAGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926796475 Original CRISPR CAGTAGGAGGAGAGGTCCTT TGG (reversed) Intronic
905014040 1:34764932-34764954 TAGCAGGAGGAGAAGGCCTTGGG - Intronic
907242064 1:53086362-53086384 CAGTGGGAGGAGGTGTCCTGGGG + Intergenic
908870488 1:68605548-68605570 CATTAGGAGGTGAGGCCTTTGGG - Intergenic
910517554 1:88079243-88079265 CAGGAAGAGGAGGGGGCCTTTGG + Intergenic
913430649 1:118787590-118787612 CATTAGGAGGGGAGGGCTTTGGG + Intergenic
916118600 1:161509039-161509061 TATTAGGAGGTGAGGTCTTTGGG + Intronic
918192314 1:182187528-182187550 TATTAGGAGGAGGGGTCTTTGGG + Intergenic
919782245 1:201228545-201228567 CAGGAGGACGTGAAGTCCTTGGG + Exonic
920843598 1:209575509-209575531 CAGGAGGAGGAGAGTTTCTGAGG - Intergenic
923126206 1:231036691-231036713 CAATGGGAGGAGAGGCCATTCGG - Intronic
1063032860 10:2253604-2253626 GAGGAGGAGGTGAGGTCCCTGGG - Intergenic
1063559150 10:7110319-7110341 TATTAGGAGGTGAGGTCTTTGGG - Intergenic
1064592143 10:16905066-16905088 TAGTTGGTGGAGAAGTCCTTGGG - Intronic
1064633548 10:17341536-17341558 TATTAGGAGGTGAGGTCTTTGGG + Intronic
1065779506 10:29153853-29153875 TATTAGGAGGTGAGGACCTTTGG - Intergenic
1065868951 10:29939819-29939841 TATTAGGAGGTGAGGTCTTTGGG + Intergenic
1066067366 10:31772155-31772177 CAGGAGGAGGAGAGGAACATGGG - Intergenic
1067827085 10:49584282-49584304 TATTAAGAGGTGAGGTCCTTGGG + Intergenic
1069103242 10:64350676-64350698 CAGTAGGAGGAGATGTAATGAGG + Intergenic
1069877929 10:71574536-71574558 CAGGAGTAGGAGGCGTCCTTGGG - Intronic
1070767113 10:79063161-79063183 CAGAAGGAGGAGAGATGCTGAGG + Intergenic
1071191322 10:83104789-83104811 CAGTATGAGCAGAGTGCCTTGGG - Intergenic
1071500825 10:86203265-86203287 CAGTGGGAGGAGGGGCCCTGAGG + Intronic
1073332791 10:102681613-102681635 CAGGAGGAGGAGAGGAACGTGGG + Intronic
1076112935 10:127874413-127874435 CAGGCCGAGGAGAGGTGCTTGGG - Intergenic
1076684018 10:132188566-132188588 CAGGAGGAGGAGAGGTGCAGCGG + Intronic
1077148492 11:1056637-1056659 CAGTGGGAAGAGAGGCCCCTGGG - Intergenic
1078114679 11:8434446-8434468 CAGTAAGTGGATAGGTCTTTAGG - Intronic
1078462147 11:11522187-11522209 CAGAATGAGGAGAGGTCATGTGG - Intronic
1078904739 11:15673298-15673320 TAGTGGGAGGAAAGGCCCTTTGG + Intergenic
1079129413 11:17738611-17738633 CAGTGGGAGGAGAGGGCCAGGGG - Intronic
1079141387 11:17812339-17812361 CAGCAGGAGGGGAGGCCCATGGG - Intronic
1083299343 11:61732160-61732182 CAGAAGGAGGACAGTTCCCTGGG + Intronic
1084193588 11:67510401-67510423 CAGTAGGAGCAGAAGACCTTGGG - Intergenic
1088022778 11:105139685-105139707 CAGTAAGAGGATAGGTCTTAGGG - Intronic
1090886430 11:130880931-130880953 CAGTAGGAGGTGGGGCCTTTGGG + Intronic
1090919616 11:131196309-131196331 CAGTAGGAGCAGAAGCCCTTCGG - Intergenic
1091461617 12:647351-647373 CACTATGATGAGAGGTGCTTTGG - Intronic
1091924651 12:4335444-4335466 CATTAGGAGGTGGGGTCTTTGGG + Intronic
1092106967 12:5928147-5928169 CAGGAGGAGGAGGTGTCCTGAGG + Intronic
1097411347 12:59256755-59256777 CATTTGGAGGTGGGGTCCTTCGG - Intergenic
1097717770 12:62984287-62984309 CAATAGGAGGTGAGGCCTTTGGG - Intergenic
1100223751 12:92535353-92535375 TATTAGGAGGTGAGGTCTTTGGG - Intergenic
1100403190 12:94250091-94250113 CAGAGGGAGCAGAGGTCCTGAGG + Intronic
1103327824 12:120133248-120133270 ATCTAGGAGGAGAGGGCCTTTGG - Intronic
1103799921 12:123531541-123531563 GGGTAGGAGTAGAGGTGCTTGGG + Intronic
1104005587 12:124890035-124890057 CAGCAGGAGGTGGGGTCCCTGGG - Intergenic
1104462119 12:128964431-128964453 CGGCAGGAGGTGAGGTCTTTGGG - Intronic
1110791729 13:79593160-79593182 CATTAGGAGGTGAGGCCTTTGGG + Intergenic
1112305074 13:98266437-98266459 AAGTAGGAGGTGAAGTCCCTGGG + Intronic
1113257114 13:108517995-108518017 CATTAGGAGGTGAGGCCTTTGGG - Intergenic
1113847255 13:113399443-113399465 AAGTGGGAGGAGAACTCCTTAGG - Intergenic
1114814359 14:25939229-25939251 CAGTAGACTGTGAGGTCCTTGGG - Intergenic
1124357035 15:29003331-29003353 CAGTAGCAGCAGATGTTCTTTGG - Intronic
1124362147 15:29045453-29045475 CATTAGGAGGTGGGGTCTTTGGG - Intronic
1124385640 15:29206323-29206345 TATTAGGAGGTGGGGTCCTTGGG - Intronic
1125054469 15:35341429-35341451 CATTTGGAGAAGAGGTCCTCTGG + Intronic
1125953697 15:43775516-43775538 CAGTGGGAAGTGAGGTACTTTGG - Exonic
1127865005 15:63025475-63025497 CAATAGGAGGTGGGGTCCCTGGG - Intergenic
1130244778 15:82236610-82236632 TGGTGGGAGGAGAGGGCCTTTGG - Intronic
1130829940 15:87589274-87589296 CAGTAGGAGGAGAGGAGGTAGGG - Intergenic
1131315867 15:91336752-91336774 CAGTAGAATGAGAGTTGCTTTGG - Intergenic
1132520299 16:384178-384200 CAGTGGGAGGAGGGGGGCTTGGG - Intronic
1136933143 16:34436470-34436492 CAGTGAGAGGAGAGGGCCCTGGG - Intergenic
1136971429 16:34975344-34975366 CAGTGAGAGGAGAGGGCCCTGGG + Intergenic
1138247029 16:55475300-55475322 AAGTAGGAGGACAGGGTCTTGGG + Intronic
1138311491 16:56027315-56027337 CAGGAAGAGGAGACGGCCTTTGG - Intergenic
1139264077 16:65623158-65623180 GAGGAGGAGGTGAGGTCCTGGGG + Intergenic
1141152546 16:81574263-81574285 CAGTTGGAGGAGGGGGCCGTGGG - Intronic
1142611689 17:1111921-1111943 CAGAAGGAGGAAGGGTCCTTTGG - Intronic
1143337926 17:6187418-6187440 CTGCAGGAGGAGAGGCCCTGTGG - Intergenic
1144825421 17:18103101-18103123 CAGCAGGAGGAGAGGACCTGAGG - Intronic
1147910638 17:43853937-43853959 CTGCAGGAGGAGAGGTCGCTGGG - Exonic
1152023000 17:77790957-77790979 CATTAGGAGGAAAGGACTTTGGG - Intergenic
1153031462 18:717321-717343 CAGTAGCAGGAATGGTCCCTGGG - Intergenic
1153171471 18:2320836-2320858 CAATAGGTGGAGAGGCCCTGAGG + Intergenic
1153260576 18:3220050-3220072 CAGGAGGAGGAGAGGGGCATGGG + Exonic
1153646382 18:7199673-7199695 TATTAGGAGGTGGGGTCCTTTGG - Intergenic
1154343260 18:13522257-13522279 TAGCAGGAGGAGAGGTCCTTTGG - Intronic
1155077000 18:22367144-22367166 CAATAGGAGGAGAGAGCCATTGG + Intergenic
1159922232 18:74236871-74236893 CAGCAGGAGGTTAGGTCCTTTGG - Intergenic
1160243089 18:77136855-77136877 CAGGTGGAGATGAGGTCCTTGGG + Intergenic
1161426168 19:4204470-4204492 GAGGATGAGGAGAGGTCCCTAGG + Intronic
1163772263 19:19198249-19198271 CAGGAGGCTGAGAGGTCCTGGGG - Intronic
1165150921 19:33759630-33759652 CAGTTGGAGGAGAGGGAATTAGG - Intronic
926097204 2:10089354-10089376 CATTAGGAGGTGGGGTCCTTGGG + Intergenic
926796475 2:16623523-16623545 CAGTAGGAGGAGAGGTCCTTTGG - Intronic
927063632 2:19447576-19447598 CAGTAGGATGAGAGGGACCTGGG + Intergenic
927193701 2:20533813-20533835 TAGCAGGAGGAGAAGTCCCTGGG - Intergenic
927809874 2:26174947-26174969 GAGTTGGAGGAGAGCTTCTTGGG + Intronic
929467005 2:42154112-42154134 CAATAGGAGGAGATGCCCTCTGG + Intergenic
930897466 2:56462737-56462759 TATTAGGAGGAGGGGGCCTTTGG - Intergenic
932117327 2:69064537-69064559 CAGTGGGAGGAGTGATCTTTGGG + Intronic
935079773 2:99781143-99781165 CAGTAGGTGCAAAGGTCCTGAGG - Intronic
936048797 2:109207055-109207077 CATTTGGAGGAGAGGGCCTGGGG + Intronic
940083349 2:149829595-149829617 CAGTAAGAACAGAGGCCCTTAGG - Intergenic
943200491 2:184817486-184817508 CATTTGGAGGAGAGGTACTCTGG - Intronic
943811416 2:192194244-192194266 CAGTAGGAGGTGAGGGGCTGAGG + Intronic
944173997 2:196809310-196809332 TAGTAGCAGGAGAGGTGCTCTGG + Exonic
946151295 2:217773296-217773318 TACTAGGAGGAGAGGGCTTTGGG - Intergenic
947538662 2:230958787-230958809 CCATAGGGTGAGAGGTCCTTGGG - Intronic
1168967161 20:1905639-1905661 GAGGAGGAGGAAAGGTCCTTAGG + Intronic
1173250112 20:41359922-41359944 CAGTGGGAGGAGAGGTTGCTGGG - Exonic
1174918433 20:54677321-54677343 CAGTAAGAGCAAAGGTCCTAGGG + Intergenic
1177094886 21:16820537-16820559 CTGTAGGAGGAGAAGGCCTAAGG - Intergenic
1181120947 22:20668521-20668543 CAGGAGGAGGAGAGGTGCCAGGG - Intergenic
1181129540 22:20722544-20722566 GAAGAGGAGGATAGGTCCTTAGG - Intronic
1181516156 22:23414922-23414944 CAGCAGGAGAAGGGGTACTTGGG - Intergenic
1181529892 22:23511472-23511494 CAGCAGGAGGAGAGGGCTCTGGG - Intergenic
1181690332 22:24555500-24555522 CAGTTGGAGGAGAGTTGCTTGGG - Exonic
1182422985 22:30257550-30257572 CAGTAGGTGCAGAGGGCCCTGGG + Intergenic
1183363326 22:37394306-37394328 CAGAGGGAGGGGAGGACCTTGGG - Intronic
1184414815 22:44346135-44346157 CAGGATGATGAGAGGTCCTGAGG + Intergenic
951682062 3:25305254-25305276 CTGTAGGAGGAGAGGTTTTAAGG + Intronic
953355790 3:42255197-42255219 CATTAGGGGGACAGGTCTTTAGG + Intergenic
953675086 3:44994777-44994799 CAGTTACAGGAGAGTTCCTTGGG + Intronic
956413478 3:69003029-69003051 GAGTAGCAGGAGAGTTTCTTTGG + Intronic
957310323 3:78510441-78510463 CATTAGGAGGAGGGGTTTTTGGG - Intergenic
958018102 3:87966268-87966290 TATTAGGAGGGGAGGTCTTTGGG - Intergenic
958686819 3:97408782-97408804 TATTAGGAGGTGAGGTCTTTGGG - Intronic
962028230 3:131571606-131571628 CAGCAGCAGGAGAGGTACTGTGG - Intronic
962346279 3:134620961-134620983 AAGCTGGAGGAGAGGTCCTGAGG + Intronic
962711608 3:138091208-138091230 CAGTAGAAGAATAGGACCTTTGG + Intronic
962975569 3:140442944-140442966 CAGTAGGAGGGGAAGACCCTTGG + Intronic
965428203 3:168553739-168553761 CATTAGGAGGGGAGGCCTTTGGG - Intergenic
966216308 3:177506737-177506759 CATCAGGAGGTGAGGTCTTTAGG + Intergenic
966625172 3:182008126-182008148 GAGTGGCAGGAGAGCTCCTTAGG - Intergenic
967935468 3:194724138-194724160 CAGAAGGGTGAGAGGTGCTTTGG + Intergenic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
971077018 4:23161660-23161682 GAGGAGGAGGAGAATTCCTTCGG - Intergenic
972660569 4:41112166-41112188 CAGAATGAGGAGAGATCATTAGG + Intronic
972803745 4:42506206-42506228 CAGTAGGAGGTGGGGTCTTTGGG + Intronic
973110851 4:46396200-46396222 CATTAGGAGGTGAGGCCTTTTGG - Intronic
973163276 4:47045747-47045769 CATTTGGAGGTGAGGTCTTTGGG - Intronic
976356399 4:84122671-84122693 CCGCAGGAGGAGAGGCCCTGAGG - Intergenic
976776417 4:88711165-88711187 TATTAGGAGGTGAGGTCTTTGGG + Intergenic
978501623 4:109416270-109416292 CAATAGGAGGAGAGGGACTATGG + Intergenic
979388607 4:120100036-120100058 TATTAGGAGGTGAGGTCTTTGGG - Intergenic
981430789 4:144657033-144657055 AAGTAAGAGCAGATGTCCTTGGG - Intronic
981473349 4:145162131-145162153 CAGTAGGAGGAAAGGTAGCTGGG - Intronic
985055265 4:186030574-186030596 CTGTAGGAGGGGAGGTCATTAGG - Intergenic
985969726 5:3365637-3365659 CAGTAGGTAGAGTGGCCCTTAGG - Intergenic
986627277 5:9734027-9734049 TAGTAGGAGGTGAGGCCTTTGGG + Intergenic
987135285 5:14894394-14894416 CATTAGGAGGTGAGGTCTTTGGG - Intergenic
987779305 5:22412793-22412815 CAGGTGGAGGAAATGTCCTTTGG - Intronic
988893953 5:35651391-35651413 CAGCAGGAGGAGAAGGCCTGGGG + Intronic
988961835 5:36378601-36378623 CAGGAGCAGGAGAGGGACTTTGG - Intergenic
989164662 5:38422487-38422509 CATTATGAGAAGAGGTCCATGGG - Intronic
989196736 5:38723836-38723858 TGGTAGGGGGAGGGGTCCTTAGG - Intergenic
990214587 5:53515820-53515842 TACTAGGAGGTGGGGTCCTTTGG + Intergenic
991022013 5:61989166-61989188 AAGAAGGAGGAGAGGTCCTTGGG + Intergenic
991179354 5:63731539-63731561 CAGAAGAAGGTGATGTCCTTAGG + Intergenic
991559299 5:67932540-67932562 CAGGAAGAGGAGAGGTCAATGGG + Intergenic
992542458 5:77778431-77778453 CAGTAGCAGCAGAGGTCTTTTGG - Intronic
992580834 5:78174248-78174270 TTGTAGGAGAAGAGGTCCTCTGG + Intronic
992667248 5:79022506-79022528 CAGTTGGGGGCCAGGTCCTTGGG + Intronic
994726817 5:103445875-103445897 AAGTGAGAGGAGATGTCCTTGGG + Intergenic
995394008 5:111667917-111667939 CAGTAGCTGGAGAGGACATTGGG + Intronic
996517912 5:124394079-124394101 CAAGAGGATGAGAGGTGCTTTGG - Intergenic
997981188 5:138468139-138468161 CAGGAGGAGGAGATGGCCATAGG + Exonic
999701858 5:154235460-154235482 CAGTACTAGGAAAGGGCCTTAGG + Intronic
1000068794 5:157719977-157719999 TTGTAGGAAGAGAGGTCCTTGGG - Intergenic
1001195133 5:169666275-169666297 CATTAGGAGGTGGGGTCCTTGGG - Intronic
1003483244 6:6552561-6552583 CCTTAGGAGGAGAGGCCTTTGGG - Intergenic
1003959734 6:11197929-11197951 AAGTTGGATGAGAGGCCCTTGGG + Intronic
1006267267 6:32935824-32935846 CTCTAGGAGTAGAGGTCCATGGG - Intronic
1006883329 6:37358422-37358444 CAGTAGGAGGCCAGGTGGTTTGG + Intronic
1007371702 6:41430453-41430475 CAGTAGGAGGACAGCTTCCTGGG + Intergenic
1007620069 6:43206566-43206588 GAGGAAGAGGAGAGGACCTTTGG + Intronic
1008054821 6:46935684-46935706 CAGGAGCAGGAGAGGGACTTGGG - Intronic
1008389171 6:50929501-50929523 CAGTAGGAGGTGAGGTCTGCGGG + Intergenic
1009198747 6:60719090-60719112 CAATAGGAAAAGAGGTCCTCAGG - Intergenic
1012360354 6:98369795-98369817 CATTAGGAGGTGAGGCCTTTTGG + Intergenic
1012558021 6:100540250-100540272 CTGTAGCAGGAGATGTGCTTTGG + Exonic
1013276925 6:108594466-108594488 CAGCAGGAGGAGAGTTCCCAGGG + Intronic
1014126649 6:117783644-117783666 CAGTGGGCAGAGAGGTCCGTGGG - Intergenic
1015920007 6:138257251-138257273 CAGTAGTAGGGGAGGACCCTGGG - Intronic
1018410295 6:163538496-163538518 CAGTAGGAGGTGAGGTCGGTGGG + Intronic
1020888900 7:13853907-13853929 CACCAGGAGGACAGCTCCTTTGG + Intergenic
1021678082 7:23101081-23101103 CCACAGGAGGATAGGTCCTTGGG - Intergenic
1021934337 7:25615125-25615147 CAGAGGGAGGAGAGGGCCCTTGG - Intergenic
1023047424 7:36222826-36222848 CATTAGGAGGTGAGGCCTTTGGG - Intronic
1023393658 7:39733108-39733130 CTGTAAGAGGAGCGGCCCTTGGG - Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028058473 7:86278454-86278476 GAGTAGGAGGGGAGGTCTATAGG + Intergenic
1032096034 7:128938946-128938968 CAGCAGGAGGAGAGGTCCAGAGG + Intronic
1032321519 7:130890310-130890332 TAGTAGGAGGAGCTGTCTTTTGG - Intergenic
1032611555 7:133420614-133420636 CAGTAGGAGGTGAGGATCATGGG + Intronic
1033146831 7:138878340-138878362 CAGTGAGAGGAGAGGCCCCTGGG + Intronic
1033846915 7:145444549-145444571 TATTAGGAGGTGAGGTCTTTGGG - Intergenic
1034140917 7:148815271-148815293 CAGTTGAAGGAGAAGTGCTTTGG - Intronic
1034155510 7:148953130-148953152 CATTTGGAGATGAGGTCCTTGGG + Intergenic
1035829664 8:2680917-2680939 CAGTAGGATGAGATGTCCACGGG - Intergenic
1036611756 8:10356393-10356415 CAGATGGAGGAGAGGCTCTTAGG - Intronic
1036783100 8:11663720-11663742 CACTTGGAGGAGAGGCCCATGGG + Intergenic
1041797900 8:61765798-61765820 CATTAGGAGGGGAGGCCATTAGG - Intergenic
1042690992 8:71498681-71498703 CAGCAGCAGAAGAGGTCCTGAGG - Intronic
1043492020 8:80759397-80759419 CTGTAGGAGGTGAGATCATTGGG - Intronic
1043656650 8:82675098-82675120 CAGGAGGAGGTGAGGTGCTCTGG - Intergenic
1045550384 8:103166113-103166135 CAGGATGAGGACATGTCCTTGGG + Intronic
1046863763 8:119123481-119123503 CATTAGAAGGTGAGGCCCTTGGG - Intergenic
1047181986 8:122597328-122597350 ATGTAGGAGCAGAGGTACTTTGG - Intergenic
1048375783 8:133821430-133821452 CACTAGGAGTTGAGGTCCTGTGG + Intergenic
1049097542 8:140557862-140557884 CAGAAGGACGAGAGGGCCTGTGG - Intronic
1049927189 9:420913-420935 AGGTAGGAGGACATGTCCTTTGG - Intronic
1049953894 9:673659-673681 CAATAACAGGAGAGGACCTTGGG + Intronic
1056115739 9:83439491-83439513 CATTAGGAGGATAGGTGCTTTGG - Intronic
1057719516 9:97520736-97520758 CAGTAAGAGGAGACTTCTTTAGG + Intronic
1059476355 9:114551052-114551074 GACTAGGAGGAGAGGTGCCTTGG - Intergenic
1059613401 9:115923299-115923321 CATTAGGAGGTGAGGCCTTTTGG - Intergenic
1186057075 X:5661185-5661207 CATTAGGAGGTGGGGTCTTTGGG + Intergenic
1186103134 X:6177841-6177863 TATCAGGAGGCGAGGTCCTTGGG + Intronic
1187719638 X:22137639-22137661 CAGTAGCAGCAGTGGTCCCTGGG + Intronic
1189199311 X:39178093-39178115 CAGTAGAAGGTGAGGTCCAAGGG - Intergenic
1189748912 X:44198677-44198699 CAGCAGGATGAGAGGTAGTTGGG + Intronic
1189974575 X:46448302-46448324 CAGAAGGAGGTGAGTTCCCTGGG + Exonic
1191214031 X:57917109-57917131 CAGGTGAAGGAGAGGTCTTTAGG + Intergenic
1192611024 X:72567178-72567200 GAGTTAGAGGAGAAGTCCTTTGG - Intronic
1193975857 X:88118107-88118129 AAGTAGCAGGAGAGATCCTATGG - Intergenic
1194668548 X:96702942-96702964 TAGTAGGAGGTGAGGTCTCTGGG - Intronic
1195347092 X:103962073-103962095 CTGTAGGAGCAGAAGTCCTCAGG - Intronic
1195360350 X:104076768-104076790 CTGTAGGAGCAGAAGTCCTCAGG + Intergenic
1196299078 X:114033710-114033732 CAGTGGTAGTAGAGGTCCTTTGG - Intergenic
1198913072 X:141635623-141635645 CAATAGGAGGTGAGGTATTTGGG + Intronic