ID: 926798849

View in Genome Browser
Species Human (GRCh38)
Location 2:16641120-16641142
Sequence CTGTGTGTGCAGAACTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926798849_926798851 5 Left 926798849 2:16641120-16641142 CCTGGACAGTTCTGCACACACAG 0: 1
1: 0
2: 1
3: 27
4: 269
Right 926798851 2:16641148-16641170 TGACTCTTCCCAAAGCAGCACGG 0: 1
1: 0
2: 0
3: 29
4: 286
926798849_926798854 27 Left 926798849 2:16641120-16641142 CCTGGACAGTTCTGCACACACAG 0: 1
1: 0
2: 1
3: 27
4: 269
Right 926798854 2:16641170-16641192 GCTATTATTGCATCACTCTATGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926798849 Original CRISPR CTGTGTGTGCAGAACTGTCC AGG (reversed) Intronic
900237859 1:1601003-1601025 CTGTGTATGCAGACGTGGCCGGG + Intergenic
900250015 1:1663861-1663883 CTGTGTGTGGAGGACAGGCCAGG - Exonic
900261048 1:1729771-1729793 CTGTGTGTGGAGGACAGGCCAGG - Intronic
900493033 1:2962234-2962256 CTGTGTGTGCTGTGCGGTCCTGG + Intergenic
900551387 1:3257941-3257963 CTGTGGGTGGGGAGCTGTCCTGG + Intronic
900959896 1:5912205-5912227 CGGTGTGTGCAGAACTGGGAAGG + Intronic
901399482 1:9006159-9006181 CAGTGTGTGTAGACCTGGCCGGG - Intronic
902819861 1:18937258-18937280 CTGTCTGTGCAGAGCCGTCATGG + Intronic
904353834 1:29925890-29925912 CAGTGTGCCCAGGACTGTCCTGG + Intergenic
905519851 1:38589307-38589329 CTGGGAGTGGAGCACTGTCCTGG + Intergenic
905668577 1:39776814-39776836 CTGTGTGTACAACACTGTTCTGG + Intronic
907232703 1:53014896-53014918 CTCAGTGTGCAGAACTCTGCTGG + Exonic
907428801 1:54398515-54398537 CTGTGTGCCCAGAGGTGTCCTGG - Intronic
910468268 1:87523608-87523630 CTGTGTGTGGGGAATTTTCCTGG + Intergenic
910910722 1:92230913-92230935 CTGTGTGTGCAGATGTCACCTGG + Intronic
911655116 1:100435058-100435080 CTGTGTCTGTGGAACTATCCGGG + Intronic
916088952 1:161292041-161292063 TTTTTTGTGCAGCACTGTCCTGG - Intergenic
920161446 1:204001406-204001428 CTGTGGGTGCAGAGCTGTGGAGG + Intergenic
920201608 1:204263038-204263060 CTGTGTGTGCAGAACTCGCTGGG + Intronic
921044827 1:211468161-211468183 CTGTGTGTGCAGAAATCACATGG - Intergenic
921738528 1:218656498-218656520 CTATGTGCTCAGAACTGTGCTGG - Intergenic
923108163 1:230869567-230869589 TTTTGTGTTCAGAACTATCCAGG - Intronic
924619738 1:245650135-245650157 CTGTCAGTGCAGAACTGACGAGG - Intronic
1066316159 10:34248656-34248678 CTGTGTGTGCAGGTGTGTGCTGG - Intronic
1068287594 10:54961217-54961239 GAGTGTGTGCACAACTGGCCAGG - Intronic
1069842757 10:71349994-71350016 CTGTGTGTCCAGTACTATGCTGG - Intronic
1069961580 10:72082270-72082292 CTCAGTGTGCAGACCTGGCCCGG - Intronic
1070356052 10:75641329-75641351 ATCTGTGTGCTGAGCTGTCCAGG + Intronic
1072435557 10:95411876-95411898 CTGTGTGTTGGGAGCTGTCCTGG - Intronic
1072690986 10:97572335-97572357 CTGGGAGTACAGAACTGTCCTGG + Intergenic
1073036945 10:100570429-100570451 GTGTGTGTGTATTACTGTCCAGG + Intergenic
1073619624 10:105033424-105033446 ATGTGTGAAAAGAACTGTCCAGG + Intronic
1075197761 10:120375771-120375793 GTGTCTGTGCATATCTGTCCTGG - Intergenic
1076050057 10:127325370-127325392 CTGTGTGTCAGGAACTGTTCTGG + Intronic
1076247807 10:128961345-128961367 CTGTGTAGGCAGCACTGCCCTGG + Intergenic
1078076053 11:8161803-8161825 GTGTGTGTGTAGAGCTGGCCTGG - Intronic
1078141232 11:8694456-8694478 CTGTGTCTGCAGACCTGTTATGG + Intronic
1078370658 11:10742014-10742036 CAGTGTGCCCAGGACTGTCCCGG + Intergenic
1081621833 11:44623391-44623413 CTGTGTGTGCACGTGTGTCCTGG - Intergenic
1082798885 11:57399066-57399088 CTGTGTTTCCAGAACTGTGCAGG - Intronic
1083223508 11:61268930-61268952 CAGTCTGGGCAGCACTGTCCAGG + Exonic
1084593657 11:70104809-70104831 CTGTGAGGCCAGCACTGTCCAGG - Intronic
1084729666 11:71065191-71065213 CCACGTGTGCAGAACTCTCCCGG + Intronic
1084947766 11:72648027-72648049 GTGTGTGTACACAAGTGTCCAGG + Intronic
1085108855 11:73869751-73869773 CTGTGTGTTAAGCACTGTACTGG + Intergenic
1085242947 11:75073794-75073816 CTCTGAGTGCAGCAATGTCCAGG - Intergenic
1085787419 11:79466541-79466563 CTCTGTGTGCAGAGTTGTTCAGG - Intergenic
1086345028 11:85887335-85887357 CTGTGGGTGGACAACAGTCCAGG + Intronic
1086666633 11:89491464-89491486 CTGAGTGGGCAGAGCTGACCCGG - Exonic
1089196740 11:116697906-116697928 CTGAGTGTGAAGCCCTGTCCTGG - Intergenic
1091677002 12:2498852-2498874 CAGTGTGTGAAGACCTGTGCAGG - Intronic
1092242439 12:6843503-6843525 CTGTGTGAGCAGAAAGCTCCCGG - Exonic
1093092481 12:14937204-14937226 CTGTGTACGCAGAACTGACAGGG + Intronic
1097179669 12:57164532-57164554 CTGTGTGCTCAGCACTGTCATGG + Intronic
1097200160 12:57271425-57271447 GTGTGTGTGTATTACTGTCCAGG - Intronic
1097905674 12:64916917-64916939 CTGTGTGTAAATAGCTGTCCTGG + Intergenic
1099034282 12:77566013-77566035 ATGTGTGTGCAGCACAGTGCAGG - Intergenic
1099325992 12:81215084-81215106 CTGTTTTTTCAGAAATGTCCAGG - Intronic
1100173519 12:92004290-92004312 CTGTTTCTGCATTACTGTCCAGG + Intronic
1100618443 12:96249596-96249618 CTGTGTGTTTACAACTGTCAGGG + Intronic
1101493012 12:105227460-105227482 CTGTGAGTGCATATCTGTCATGG - Intronic
1102412607 12:112733174-112733196 GTGTGTGTGCAAATCTGTGCAGG - Intronic
1102580220 12:113881721-113881743 ATGGGTGTGAACAACTGTCCTGG + Intronic
1102941745 12:116948568-116948590 CTGTATGTTAAGAACTGTGCTGG + Intronic
1103419857 12:120771687-120771709 CTGTGTTTGCAGAACAGTGGAGG - Intronic
1103982059 12:124742962-124742984 CTGTGTGGGCAGAGCTGGGCGGG - Intergenic
1104149735 12:126071015-126071037 GAGTGTGTGCAGAGCTGTTCTGG - Intergenic
1104769334 12:131351215-131351237 CTGTGTGTGAACACCTGCCCGGG - Intergenic
1106789724 13:33142490-33142512 CTGTGGGTGCAGTACTGTCTTGG - Intronic
1107357649 13:39584862-39584884 CTGTGTGTGCACAGTTGTCTTGG - Intronic
1107905064 13:45054104-45054126 CTGTGAGTGCAGAATGGTACAGG + Intergenic
1109259346 13:60124789-60124811 CTGTGTTTGCACCACTGCCCTGG + Intronic
1110985080 13:81956779-81956801 CTGTGTCTGCAATACTGTGCAGG - Intergenic
1112263689 13:97902587-97902609 CCATGTGTGCAGAACTGTGCTGG - Intergenic
1112592053 13:100772573-100772595 CTGTGTGTCAAGAACTGTGAAGG - Intergenic
1113299028 13:108996254-108996276 CAGTGTGTGGAAAACTGTACAGG + Intronic
1115649769 14:35394599-35394621 CTGTGTGTGCACAACTTCCCAGG - Intergenic
1115742027 14:36398677-36398699 GTGTGTGTGCAGAAGTCACCAGG + Intergenic
1116167864 14:41356755-41356777 CAGTTTGTGCAGGACAGTCCTGG + Intergenic
1116669336 14:47821263-47821285 CTGTGTGTGCTGAGCTGCCTGGG + Intergenic
1118799022 14:69172200-69172222 ATGTGACTGCAAAACTGTCCTGG + Intergenic
1119162595 14:72465505-72465527 CTATGTGCCCAGCACTGTCCTGG - Intronic
1119565139 14:75622374-75622396 CTGTGTGGGGACAACTGCCCAGG - Intronic
1119905388 14:78297562-78297584 TTGTGTTTGCAGAACTGCTCTGG - Intronic
1121662370 14:95645074-95645096 CTGTGTGTGAAGTGCTGTGCTGG + Intergenic
1121999698 14:98636673-98636695 GTGGGTGTGGAGAACTTTCCAGG - Intergenic
1122272068 14:100572752-100572774 CTGTGTGTAAGGGACTGTCCTGG + Intronic
1122982777 14:105199084-105199106 CTGTGTGAGCAGAAGCTTCCTGG + Intergenic
1123985832 15:25645081-25645103 CTGTATATGCACAACTGTGCAGG + Intergenic
1124420984 15:29521716-29521738 CTGTGCGTGCAGTGCTGTTCAGG - Intronic
1124687278 15:31793064-31793086 CTGTGTGTGCAGTGGTGTCATGG - Intronic
1124814021 15:32969948-32969970 CTGTGTCTGCTGTATTGTCCTGG - Intronic
1124849044 15:33318161-33318183 CTGCCTGTGCAGAATTGTACAGG + Intronic
1125534273 15:40434457-40434479 CTGTGTGTCTAGCACAGTCCTGG - Intronic
1125782634 15:42283794-42283816 CTGTGTCTGCAGAAATGGCCAGG + Intronic
1127048215 15:55050555-55050577 CTGTGTGCCAAGAACTGTACTGG + Intergenic
1128379567 15:67102583-67102605 CTGTGTGTATAGACTTGTCCTGG + Intronic
1130080458 15:80728341-80728363 CTGTGTGTGAATAGCAGTCCTGG - Intronic
1131026974 15:89151560-89151582 CTTTGTGTGCAGAATTTCCCTGG + Intronic
1132315395 15:100886542-100886564 CTGTGTGTCCAGAGCTGGCTTGG - Intronic
1132538797 16:497619-497641 CAGTGTGGGGAGACCTGTCCAGG - Intronic
1132998493 16:2836782-2836804 CTGTGTGCGCACCACAGTCCAGG + Intronic
1134006701 16:10822791-10822813 CTGTGTGTGTACCTCTGTCCAGG - Intergenic
1134420501 16:14083455-14083477 CTGTGCCTTCAGACCTGTCCTGG - Intronic
1134913636 16:18051036-18051058 AAGTGTGTGCAAAATTGTCCTGG - Intergenic
1137878169 16:52017638-52017660 CAGTTTGTCCAGGACTGTCCTGG + Intronic
1140020850 16:71237301-71237323 CTATGACTGCAGAACTGCCCTGG - Intergenic
1140128466 16:72137234-72137256 CTGTGTGCCCGGCACTGTCCTGG + Intronic
1141768339 16:86073369-86073391 CTGTGGGAGCAGACCTGCCCTGG + Intergenic
1142282109 16:89154078-89154100 TTGTCTCTGCAGAAATGTCCTGG + Exonic
1142769633 17:2087344-2087366 CGGTGTGTGCCGCACTTTCCTGG - Intronic
1143340591 17:6207916-6207938 CAGTGTGTGCAGACCTGGCCTGG + Intergenic
1143637921 17:8176895-8176917 CTGTGACTGCAGAGCAGTCCAGG - Intergenic
1144429441 17:15177645-15177667 CAGTCTGTGCAGAACTGTGCGGG - Intergenic
1144862854 17:18316403-18316425 TTCTGTGTGTAGCACTGTCCTGG - Exonic
1146767859 17:35540245-35540267 CTGTTTGTACAGAATTATCCTGG + Intergenic
1146793458 17:35765729-35765751 GTGTGTGTGCAGAGCTGTGATGG - Intronic
1147162851 17:38578173-38578195 CTGTTTGGGCAGAACTCTTCTGG - Intronic
1148811623 17:50296546-50296568 CCGTCTGTGGACAACTGTCCTGG + Intergenic
1149216817 17:54365968-54365990 CTGTATGTAAAGAACTGTTCTGG + Intergenic
1149429848 17:56588916-56588938 CTGTGAGTTCTGAACTGGCCAGG + Intergenic
1150588056 17:66536235-66536257 CTGTGTGACTAGAACTTTCCTGG + Intronic
1150812677 17:68368936-68368958 CTGTGTGTGCAAACCTTTCCAGG - Intronic
1150952737 17:69821519-69821541 CTGTGTGTGCACACCTAGCCAGG - Intergenic
1151362303 17:73596094-73596116 CTGTGTGTGCATCCCTGCCCAGG - Intronic
1151459155 17:74244376-74244398 CTGGGTGTGAAGAACTGACCGGG + Intronic
1152651072 17:81493234-81493256 TTGTGTGGGCAGAAGTGCCCTGG - Intergenic
1152661556 17:81544676-81544698 CTGTGTGTGCAGAATAAGCCCGG - Intronic
1152662862 17:81551012-81551034 CTGTTTGAGCAGCCCTGTCCTGG - Exonic
1154392696 18:13954463-13954485 CTGTTTCTGCAGAATTATCCAGG + Intergenic
1155102679 18:22628369-22628391 CTATGTGGCCAGAACTGTGCTGG - Intergenic
1157323213 18:46649740-46649762 CTGGGTGTGCAGAGCTTTGCAGG + Intronic
1157882216 18:51331302-51331324 CAGTGTGTTCAGACCTCTCCTGG + Intergenic
1157996907 18:52569172-52569194 CTGTGTGTGAAGCACTGGGCTGG + Intronic
1160220525 18:76974126-76974148 CTGTGTGTGCAGGCATCTCCTGG + Intergenic
1161062280 19:2221301-2221323 CTGCGAGGGCAGAACTGCCCGGG - Intronic
1161301731 19:3545992-3546014 CTGTGTGTCCAGCAGTGTTCTGG - Intronic
1163768011 19:19174076-19174098 CTGAGTGTGCAGGACTCTCCGGG + Intronic
1166467780 19:43048322-43048344 CTGTCTGTGCACAAATGTCAAGG - Intronic
1168402493 19:56093442-56093464 CGGTGCGTGCAGCACAGTCCAGG - Intronic
925005801 2:442268-442290 CTGTGTGTGCACAGCTGTGGGGG - Intergenic
925005882 2:442828-442850 CTGTGTGTGCACAGCTGTGGGGG - Intergenic
925015858 2:523693-523715 CTGTGTGAGGAGAGCTGTGCCGG + Intergenic
926190597 2:10724526-10724548 CTGTGTGTGAGGCACTGTGCTGG + Intronic
926798849 2:16641120-16641142 CTGTGTGTGCAGAACTGTCCAGG - Intronic
927711804 2:25330768-25330790 GGGTCTGTGCAGAGCTGTCCGGG - Intronic
928288235 2:30012148-30012170 CTGTGTGTGCAGAGGTCTCATGG - Intergenic
930266122 2:49201120-49201142 CTGTGTATTCATAACTGTGCGGG - Intergenic
930517487 2:52426384-52426406 CTTTGGGTGCAAAACTGTCAAGG - Intergenic
930540434 2:52699199-52699221 ATGTGTGTGCACATGTGTCCTGG + Intergenic
931457535 2:62423998-62424020 ATGGGTGGGCAGAAGTGTCCAGG + Intergenic
932485995 2:72084728-72084750 CTGTGTGGGCACCTCTGTCCTGG - Intergenic
932654812 2:73601323-73601345 CTGCGGGAGCAGAACTGTCAGGG + Exonic
933483833 2:82893321-82893343 CTGTGTATTCAGAGCTGTACTGG - Intergenic
934126095 2:88892364-88892386 CTGTCTGTGCACAGCAGTCCTGG - Intergenic
934769004 2:96896071-96896093 CTGAGTGGGCAGAACTGTTCTGG - Intronic
935218303 2:100991500-100991522 CTTTGTGTCCAGAACTAACCAGG + Intronic
935269760 2:101423795-101423817 CGGTGTGTGCAGCACTGTGTGGG - Intronic
935553289 2:104480699-104480721 CTGTGCATGCAGAGCTGTCTTGG + Intergenic
935655511 2:105419552-105419574 TTGTTTGTGCAGACCTGTCTTGG - Intronic
937244517 2:120483958-120483980 TTGTGTGTGCTGAACTGATCTGG - Intergenic
937300978 2:120841622-120841644 CTGTGTGCCCAGCACTGTCCTGG + Intronic
938060434 2:128250513-128250535 CTGTGAGTGGAGAACAGCCCAGG + Intronic
939765124 2:146238762-146238784 CTGCGTGTGCTGAAGTGTCCAGG + Intergenic
939792885 2:146601718-146601740 CTGAGGGTCCAGACCTGTCCTGG + Intergenic
942323098 2:174753184-174753206 CTGTGTGCCCAGAAGTGTACTGG - Intronic
942678110 2:178450228-178450250 CTGTGTATACAGACCTGTGCAGG + Exonic
944183288 2:196919872-196919894 CTGTGTGTGAAGTGCTGTGCTGG - Intronic
948698916 2:239748478-239748500 CTCTGAGTGCAGACCTGTCAGGG - Intergenic
948936499 2:241168597-241168619 CTCTGTGAGCAGACCTGACCAGG + Intronic
1169223850 20:3843737-3843759 CTGTCTGTGCTGAACTTTACTGG + Intergenic
1175723329 20:61300643-61300665 CTGTGTGGGCAGAACAGGGCAGG - Intronic
1175731951 20:61360196-61360218 CTGGGTGTGCAGATCTGTGCTGG + Intronic
1178256628 21:31058849-31058871 GTGGGTTTGCAGCACTGTCCTGG + Intergenic
1179526909 21:41984938-41984960 TTGTGTGTGAAGCACTGTACAGG - Intergenic
1179921767 21:44511219-44511241 CTGTGTGTGCAGGTGTGTGCAGG - Intronic
1180091093 21:45534188-45534210 CTGTGTTTACAGCAATGTCCTGG + Intronic
1182112710 22:27734643-27734665 CTGTGTGTGCAGAAGTGGATGGG - Intergenic
1182466014 22:30516739-30516761 ATGTGACTGCAAAACTGTCCTGG - Intergenic
1183748528 22:39705951-39705973 CTGTGTGTGCAGACCCTGCCTGG + Intergenic
1184133377 22:42531148-42531170 GTGTGAGTGGAGGACTGTCCAGG + Intergenic
1184170627 22:42757494-42757516 CTGTGAGTGCAGAAGAGGCCAGG - Intergenic
1184797269 22:46739428-46739450 CGGTGGCTGCAGGACTGTCCTGG - Intergenic
949275733 3:2278019-2278041 AAGTGTGTGCAGGACTGTCTAGG + Intronic
950675454 3:14551589-14551611 CTGTTTCTGCAGGGCTGTCCCGG + Intergenic
950684223 3:14605013-14605035 CTTTGTGAGCAGCACTGTCTGGG - Intergenic
956447111 3:69336312-69336334 CTGTGTGTTCACAACCTTCCAGG + Intronic
956829726 3:73034339-73034361 TTGTGTGTGTAGAATTTTCCAGG + Intronic
960051247 3:113241355-113241377 TTGTGTGTGCAGATGTGTGCAGG - Intronic
961779120 3:129311264-129311286 CAGTGTCTGCAGAGCTGTCCTGG + Intergenic
962904830 3:139792091-139792113 CAATGTGTTCAGAACTGTCCTGG + Intergenic
962932852 3:140053540-140053562 ATGTGTGTGGAGGACTGCCCAGG + Intronic
963478097 3:145832243-145832265 CTGTGTGTGCAGAGATGACATGG + Intergenic
965980267 3:174681561-174681583 GTGTGTGTCCAGAAATGTCCAGG - Intronic
967124034 3:186408794-186408816 CTGTGTGTTAAGCACTGTGCTGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968518177 4:1023523-1023545 CTGGGTGTCCAGGGCTGTCCCGG + Intronic
972017063 4:34260997-34261019 CTGTGTGTGGAGACCTTGCCTGG - Intergenic
972531562 4:39966012-39966034 CTGTTTGTGTAGAACTGTTCTGG - Intronic
973314790 4:48748665-48748687 CTGTGTGTCAGGCACTGTCCTGG + Intronic
976043928 4:80921693-80921715 CTGTGTGTGCAAAACACCCCTGG + Intronic
978701445 4:111651374-111651396 TTGTGTTTGCAGAACTATCTGGG - Intergenic
984745018 4:183206707-183206729 CTGTGTCTGCAGACATGTACTGG - Intronic
985484812 5:142065-142087 GTGTGTGTGCGGCACTCTCCGGG - Intronic
987086426 5:14473757-14473779 CTGTGAATGCTGAACAGTCCAGG + Intronic
988691671 5:33578528-33578550 CTGTGTCCTCAGAACTATCCTGG - Intronic
991699112 5:69300751-69300773 CTGTGTGTGCAGATCTCAGCTGG + Intronic
992047863 5:72914931-72914953 GTATGTGTGCATAACTGTCATGG + Exonic
998142461 5:139707884-139707906 CTGTGTGTTGAGGACTGTTCTGG + Intergenic
999410306 5:151344435-151344457 CAGTTTGCCCAGAACTGTCCTGG + Intronic
999622879 5:153490414-153490436 CTGTGTGTGCAGAAAGGTGGAGG - Intronic
1000237673 5:159377375-159377397 CTGTGTCTGCAGTAGTGTGCCGG - Intergenic
1000561788 5:162798481-162798503 CTTTCTGGGCAGAACTGTCTGGG - Intergenic
1000909148 5:166999843-166999865 GTGTGTGAGCAGAATTGCCCAGG + Intergenic
1002259038 5:177981638-177981660 CGGTGTGGGCAGTGCTGTCCTGG + Intergenic
1002602567 5:180362320-180362342 GTGTCTGTCCAGGACTGTCCTGG + Intergenic
1003008563 6:2404883-2404905 GTGTGTGTACAGAACAGCCCAGG - Intergenic
1003953921 6:11144810-11144832 CTGTGTGGCCAGAACAATCCTGG - Intergenic
1004153407 6:13143470-13143492 CTGTGTGTGCAGATATCTCCTGG + Intronic
1004631231 6:17423237-17423259 CTGTGTGAGCACAAATGTGCTGG + Intronic
1004798427 6:19115900-19115922 CTCTGTGTGTAGTGCTGTCCTGG + Intergenic
1005806299 6:29477005-29477027 CTTTGTGTGAAGAATTGTGCAGG + Intergenic
1006622958 6:35379486-35379508 CTATGTGTTCAGTACTGTGCTGG + Intronic
1007162607 6:39804025-39804047 CTGTGTGGGCATTGCTGTCCTGG + Intronic
1012498625 6:99863489-99863511 CTGTCTGGGCACAACTGTCCTGG - Intergenic
1013784268 6:113762182-113762204 CCTTCTGTGCAGAACTGTACAGG + Intergenic
1014168841 6:118255452-118255474 CGGTGAGAGCAGAGCTGTCCTGG - Intronic
1015692528 6:135940783-135940805 GTGTATATGCAGAAATGTCCTGG + Intronic
1016801102 6:148169780-148169802 GTGTGCGAGCAAAACTGTCCTGG - Intergenic
1017587852 6:155946967-155946989 CTGAGAGTGCAGGAATGTCCAGG - Intergenic
1018393522 6:163359283-163359305 CTGTGTCCGCAGAACTTCCCTGG - Intergenic
1018825393 6:167404882-167404904 AGGTCCGTGCAGAACTGTCCTGG - Intergenic
1018959754 6:168440297-168440319 CTGGGTGTGCAAAAATTTCCTGG + Intergenic
1018962914 6:168460971-168460993 CTGTGTCTGTAGAAGTGCCCAGG + Intronic
1019317010 7:391484-391506 CTGTGTGTGCAGAAGCAGCCAGG + Intergenic
1019363664 7:619229-619251 CTGTGTGTGGGGATCTGGCCTGG - Intronic
1020035876 7:4962821-4962843 CTATGGGGGCAGGACTGTCCTGG + Intergenic
1021488337 7:21191166-21191188 TTGTGTGTGCAGAACTCCGCTGG + Intergenic
1021680259 7:23123383-23123405 CTGTGTTTGAAAAACTGTCAGGG + Intronic
1022505638 7:30907379-30907401 CTGTGGGTGCAGGCCTGTGCGGG + Intergenic
1023139812 7:37090729-37090751 CTGTTTGTGAAGAACTGGGCAGG - Intronic
1023882616 7:44328976-44328998 CTGTGTGCCCAGCTCTGTCCAGG + Intronic
1024564595 7:50671116-50671138 CTGTGTGTCCAGGAGTGCCCTGG - Intronic
1025865170 7:65374244-65374266 CTGCGGGTGCAGAGCTGCCCAGG - Intronic
1026134113 7:67644293-67644315 CTGCCTGAGCAGCACTGTCCTGG + Intergenic
1026288451 7:68984596-68984618 GTGTGTGTCCAGAGCTTTCCTGG + Intergenic
1029891604 7:103935759-103935781 CTGTGTGTCAGGAACTGTTCTGG + Intronic
1030225728 7:107148135-107148157 CTGTGGGTGAAGGACTGTCCTGG - Intronic
1030574789 7:111272550-111272572 CTATGTGTGAAGCACTGTACAGG - Intronic
1032154147 7:129454484-129454506 CTGTGGGTGGAGAACAGCCCGGG + Exonic
1032455117 7:132067264-132067286 CTGTGTGTACAGGACCGTGCAGG - Intergenic
1033458404 7:141522964-141522986 CTGTGTGTTTGGAACTTTCCTGG + Intergenic
1035276677 7:157752153-157752175 CTGTGTCTGCAGCTCTGGCCTGG + Intronic
1035311893 7:157974822-157974844 CTGTGGGTGAAGAGCTGTGCGGG + Intronic
1035907061 8:3524568-3524590 TTGTGTGTGCATAAGTGTCTGGG - Intronic
1037084326 8:14828576-14828598 CTTTGTCTTCAGAACTGTACTGG - Intronic
1038253744 8:25930827-25930849 CTGTGTGTCCAGAGATGGCCTGG - Intronic
1038681777 8:29675199-29675221 CTGTGTTTGAAGAAATTTCCTGG - Intergenic
1040571904 8:48618988-48619010 TTCTGTGTGCACAACTGTCCAGG + Intergenic
1040725472 8:50377491-50377513 CTGTGTTTGCAGTACTTTTCTGG + Intronic
1041719539 8:60963818-60963840 TTGTGTGTGCACAGCTGTTCGGG + Intergenic
1041911960 8:63098261-63098283 TTGTCTGTGAATAACTGTCCAGG - Intergenic
1044355587 8:91219039-91219061 CTGTGTATGCAGAGCTGACAGGG - Intronic
1045048692 8:98303127-98303149 CTGTCTGTGGAGGACTGGCCTGG - Intergenic
1046728648 8:117701284-117701306 CCATGTGCACAGAACTGTCCAGG - Intergenic
1048332809 8:133482590-133482612 CTGTCTGTGCAGAGCTGGCCTGG - Intronic
1048552358 8:135445351-135445373 CTGTGTGGGGAGAGCTGTCGTGG - Intergenic
1049773096 8:144392764-144392786 GGGTGTGTGCAGGGCTGTCCGGG + Exonic
1049950203 9:636239-636261 CTTTATATGCAGAACTCTCCTGG + Intronic
1051667475 9:19478935-19478957 TGGTTTGTCCAGAACTGTCCTGG + Intergenic
1051916718 9:22217316-22217338 GGGTGTGTCCAGAAATGTCCAGG - Intergenic
1052927936 9:34033009-34033031 CTGTGTGTTGAGTACTGTCATGG - Intronic
1053391515 9:37739752-37739774 TTGTGTGGGCAGCACTGCCCAGG - Intronic
1055101280 9:72468184-72468206 CACTGTGTCCAGAACTCTCCTGG + Intergenic
1055220922 9:73930302-73930324 TTGTGTGTGCAGAATTGTTAGGG - Intergenic
1055644292 9:78348216-78348238 CTGTGCGTACAGAAATCTCCTGG + Intergenic
1056774350 9:89499964-89499986 CAATATGTGCAAAACTGTCCCGG + Intergenic
1057510914 9:95678813-95678835 CTGAGAGTGCAGAAATGTCTGGG + Intergenic
1057857848 9:98615735-98615757 GTGTGTGCCCAGAACTGTGCTGG + Intronic
1059683253 9:116606742-116606764 CTGTGTCTCAAGAACTGTGCTGG + Intronic
1060320314 9:122553106-122553128 CTGTGTGGCCAGAACTGTGCTGG - Exonic
1062475400 9:136724239-136724261 CTGTGTTTGGGGAACTGCCCTGG - Intergenic
1062591612 9:137277149-137277171 CTGTGTGTGCTGGCCTGTCCTGG + Intergenic
1185529587 X:806860-806882 CTGTGTCTGCAGAGCTGTGGTGG - Intergenic
1187011345 X:15283578-15283600 CTGTGTGTCCGGAAGTGTCTCGG - Exonic
1187400355 X:18954156-18954178 CTGTGTGTGCAGAACTGTTTGGG - Intronic
1188254062 X:27937628-27937650 CTGTATTTGCTGAACTGTGCTGG + Intergenic
1188257311 X:27978780-27978802 GTGTGTGTGCATAGCTGGCCAGG + Exonic
1191786557 X:64922624-64922646 CTTTGTGTTCAGGACTTTCCTGG - Intronic
1192087745 X:68117709-68117731 CAGAGTGTGGAGACCTGTCCTGG + Intronic
1192393366 X:70753816-70753838 GGGTTTGTGCAGAAATGTCCGGG - Intronic
1193716106 X:84936070-84936092 CTGTGTGTGCACCACTCACCTGG - Intergenic
1195885127 X:109629685-109629707 CTTTGTGTGAAGCACTGTGCTGG + Intronic
1196444016 X:115736088-115736110 GTGGGTGTGAAGAGCTGTCCGGG + Intergenic
1197579731 X:128266850-128266872 CTGTTTGTACAGAATTGTCTAGG + Intergenic
1200891715 Y:8331066-8331088 CTGTGTGCACAGCACTGTCAGGG - Intergenic
1202073556 Y:21016631-21016653 CTGTGTGTGCAAACTTGGCCAGG + Intergenic
1202078256 Y:21058485-21058507 CTGTGTGTGCAAACTTGGCCAGG + Intergenic