ID: 926799125

View in Genome Browser
Species Human (GRCh38)
Location 2:16643648-16643670
Sequence GGGCGAATACAGATAGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926799125_926799131 6 Left 926799125 2:16643648-16643670 CCCAGTTCTATCTGTATTCGCCC 0: 1
1: 0
2: 1
3: 4
4: 59
Right 926799131 2:16643677-16643699 AGACACTCTGCAGGCTTCCAGGG 0: 1
1: 0
2: 2
3: 29
4: 237
926799125_926799130 5 Left 926799125 2:16643648-16643670 CCCAGTTCTATCTGTATTCGCCC 0: 1
1: 0
2: 1
3: 4
4: 59
Right 926799130 2:16643676-16643698 CAGACACTCTGCAGGCTTCCAGG 0: 1
1: 0
2: 2
3: 30
4: 266
926799125_926799132 11 Left 926799125 2:16643648-16643670 CCCAGTTCTATCTGTATTCGCCC 0: 1
1: 0
2: 1
3: 4
4: 59
Right 926799132 2:16643682-16643704 CTCTGCAGGCTTCCAGGGCCAGG 0: 1
1: 0
2: 7
3: 44
4: 438
926799125_926799128 -3 Left 926799125 2:16643648-16643670 CCCAGTTCTATCTGTATTCGCCC 0: 1
1: 0
2: 1
3: 4
4: 59
Right 926799128 2:16643668-16643690 CCCACAATCAGACACTCTGCAGG 0: 1
1: 0
2: 3
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926799125 Original CRISPR GGGCGAATACAGATAGAACT GGG (reversed) Intronic
904434291 1:30484259-30484281 GGGCAAGTAAAGACAGAACTTGG - Intergenic
906983629 1:50658707-50658729 TGGCTAATGCAGACAGAACTTGG + Intronic
907411679 1:54287757-54287779 AGGCCAAGACAGACAGAACTGGG + Intronic
907930123 1:58991317-58991339 GGGAGAGTACTGATAGAACCTGG - Intergenic
910526677 1:88186667-88186689 GGGAGATTACACATATAACTGGG + Intergenic
916323550 1:163532803-163532825 TGGCAAATACAGATATCACTAGG + Intergenic
920299304 1:204978694-204978716 GGGCTTATGCAGACAGAACTGGG - Intronic
922915868 1:229257266-229257288 AGACGAATACAGAAAGAAATGGG - Intergenic
923427475 1:233885720-233885742 GGGCCAAAACAGCTAGAAATGGG + Intergenic
1065334678 10:24644494-24644516 GGAGGAAGACAGATAGAAGTGGG - Intronic
1066317061 10:34258591-34258613 GGGCTTATAAAGAGAGAACTGGG + Intronic
1072359620 10:94647024-94647046 TGGGGAGTACAGATAGAATTTGG + Intergenic
1086359390 11:86041546-86041568 GAAAGAATTCAGATAGAACTGGG + Intronic
1086537620 11:87867039-87867061 GGTTGAATACAGACATAACTGGG + Intergenic
1096623999 12:52882094-52882116 GGCCTAGTACAGATAGCACTTGG - Intergenic
1100712557 12:97273935-97273957 GGGCAAACTCTGATAGAACTTGG - Intergenic
1115876495 14:37867580-37867602 GGGCGCATTCAGAGAGACCTAGG + Intronic
1119889910 14:78174864-78174886 GGGCGGATACAGATTGAAGGGGG + Intergenic
1124800216 15:32825349-32825371 GGGCGAATACAACTAGAACTAGG - Intronic
1130605846 15:85315946-85315968 GGGCTGCTACATATAGAACTAGG - Intergenic
1134780768 16:16893147-16893169 GGGAGAAAACAAATAGACCTGGG + Intergenic
1140014838 16:71171939-71171961 GGGGTGATCCAGATAGAACTGGG + Intronic
1140130015 16:72152296-72152318 GGGAGAATACATACAGGACTCGG - Intronic
1142106327 16:88304960-88304982 GGGGGATTCCAGATGGAACTTGG - Intergenic
1149189022 17:54036304-54036326 TGGAGAATACAGATAGAAGCAGG + Intergenic
1150567523 17:66355023-66355045 GGGCGAAAACAGAGTGAACGTGG + Intronic
1162483725 19:10945565-10945587 GGGTGAAGACATAGAGAACTCGG - Intergenic
1165707666 19:37987994-37988016 GGGAGAATAGAGAGAGAATTTGG - Intronic
925518104 2:4707441-4707463 GGGAGAATAAAGAAAGAAATGGG + Intergenic
926799125 2:16643648-16643670 GGGCGAATACAGATAGAACTGGG - Intronic
938084981 2:128393681-128393703 GGGCGAAAAGAGAATGAACTTGG - Intergenic
941543271 2:166813882-166813904 GGGAGAATACAGATAAAATCAGG - Intergenic
944091103 2:195912754-195912776 GGGAGAAAACAGAAAGAAGTAGG - Intronic
944509330 2:200449001-200449023 GGGCAAATACACATATAACATGG + Intronic
948628909 2:239289076-239289098 GGTCCAAAACAGATTGAACTTGG + Intronic
1170345033 20:15376313-15376335 GGTTGGATACAGAGAGAACTTGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
960529134 3:118743679-118743701 AGGAGAGTACAGATAGAACATGG + Intergenic
962351621 3:134660503-134660525 GGGCAAATAATGATAGACCTTGG - Intronic
967765869 3:193278722-193278744 GTGTGAAGACAGACAGAACTGGG - Intronic
970063513 4:12064124-12064146 GGGGGCATACAGATAAAAATAGG - Intergenic
970109512 4:12621825-12621847 TGGCAAATACAGAAAGAACAAGG + Intergenic
973733901 4:53851167-53851189 GGGTGAAAACAGATGGGACTGGG - Intronic
975137664 4:70890167-70890189 GGGAGAATATAGCTTGAACTAGG + Intergenic
977340359 4:95750090-95750112 GGTGGAATACAGACAGATCTGGG - Intergenic
978573949 4:110169686-110169708 GGGAGAATCCAGAGAGAACTGGG - Intronic
980815894 4:137946057-137946079 GGGTGAATTAAGGTAGAACTAGG + Intergenic
981301158 4:143186664-143186686 GGAGGAATACAGATAGAATGAGG + Intronic
986315612 5:6584479-6584501 GGGAGAACACAGAGAGGACTGGG - Intergenic
989291827 5:39776365-39776387 GGGAGAATACAGACAGAGTTCGG - Intergenic
1005962925 6:30706134-30706156 TGGAGAAAAGAGATAGAACTTGG + Intronic
1009308247 6:62119173-62119195 TGGAGAACACTGATAGAACTTGG + Intronic
1009717111 6:67412109-67412131 GGGCTAATAAAGATAGAAAAAGG - Intergenic
1010731637 6:79397424-79397446 AGGAGAACACAGGTAGAACTAGG + Intergenic
1022656070 7:32320312-32320334 GGGGGAAAACAGGTAGAACTGGG + Intergenic
1025242882 7:57292818-57292840 TGGGGAATACAGATAAAACTTGG + Intergenic
1030148578 7:106380477-106380499 GGGAGAAAACAGAGAGAACCTGG + Intergenic
1032998877 7:137480893-137480915 GGTAGAATAAAGAGAGAACTAGG - Intronic
1036704913 8:11039691-11039713 GGGCGAGTACAGATGGGAATTGG - Intronic
1047595455 8:126373391-126373413 AGGCGTATAAAGATAGAAATGGG - Intergenic
1053433201 9:38057781-38057803 GGGAGAATGCAAACAGAACTAGG - Intronic
1062502787 9:136858458-136858480 GGGCGGATACAGCTGGGACTGGG + Exonic
1192972373 X:76246713-76246735 AGGGGAAAACAGATATAACTAGG - Intergenic
1196862116 X:120038377-120038399 GGCCCAAAACAGAGAGAACTTGG - Intergenic
1196880986 X:120197967-120197989 GGCCCAAAACAGAGAGAACTTGG + Intergenic