ID: 926799676

View in Genome Browser
Species Human (GRCh38)
Location 2:16649035-16649057
Sequence TGGAATTCAACCGACCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926799671_926799676 4 Left 926799671 2:16649008-16649030 CCTTTCATATTCACAGTTCCACA 0: 1
1: 2
2: 5
3: 33
4: 322
Right 926799676 2:16649035-16649057 TGGAATTCAACCGACCAGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926799676 Original CRISPR TGGAATTCAACCGACCAGGT TGG Intronic
904840234 1:33367835-33367857 TGGAAGTTAACTGACCAGGAAGG + Intronic
908008373 1:59749994-59750016 TGGAAGTCAAGAGACCAGTTAGG + Intronic
909601281 1:77464250-77464272 TGGCATTCAATCTGCCAGGTGGG - Intronic
915823960 1:159056218-159056240 TGAAATTCAAACTGCCAGGTGGG - Intergenic
917077287 1:171218635-171218657 TGGAATTCGAATGACCAGGTGGG - Intergenic
919264262 1:195240226-195240248 TAGAATTCAACCAACTAGATTGG - Intergenic
1063368828 10:5507845-5507867 TGGACTTCAGCCCAGCAGGTAGG - Intergenic
1065006598 10:21386199-21386221 TGGAATTCCAGCAACCAGTTTGG - Intergenic
1069197409 10:65570528-65570550 TGGAATTCAAACGGCTGGGTAGG + Intergenic
1088685713 11:112282982-112283004 TGTAATTCAAGTGACCATGTTGG + Intergenic
1090487566 11:127127733-127127755 TGGAATTCAATTGGCTAGGTGGG - Intergenic
1091423113 12:360817-360839 TGGAATTCAACAGACAGAGTAGG + Intronic
1096990819 12:55801229-55801251 AGGAGTTCAAGCGACCAGCTTGG + Intronic
1100445314 12:94654725-94654747 TGGAATTCAAATCACCAGTTAGG + Intergenic
1105008966 12:132741808-132741830 TGGAACTCAACCAACCAAGAAGG - Intronic
1106304516 13:28497555-28497577 TGGAATTCAACACGCCTGGTGGG + Intergenic
1113007479 13:105723492-105723514 TGAAATTCAAGAGAACAGGTGGG - Intergenic
1122099156 14:99393600-99393622 AGGAATTCAAACAGCCAGGTGGG + Intergenic
1124364935 15:29064579-29064601 GGGAAGTCAGCCGACAAGGTGGG + Intronic
1129982695 15:79888848-79888870 TATAATTCAACCCACAAGGTAGG + Intronic
1137255784 16:46774154-46774176 AGGAATTCAACTGACCAGCCTGG - Intronic
1140569082 16:76081315-76081337 TGAAATTAAACCCAGCAGGTAGG + Intergenic
1140572392 16:76123443-76123465 TGGAAATCAATCCACCAGTTTGG + Intergenic
1141202029 16:81905490-81905512 TGGGATTCCATTGACCAGGTGGG + Exonic
1144081758 17:11769547-11769569 AGGAATTTAACAGACCAGGGAGG - Intronic
1145710539 17:26969327-26969349 GGCAATGCAACCAACCAGGTAGG - Intergenic
1150038038 17:61825676-61825698 GGGAATACAACTAACCAGGTAGG + Intronic
1150282634 17:63938327-63938349 TGGAATCCAAGAGACCAGATAGG - Intergenic
1155671278 18:28374698-28374720 TGGAATTCTCCAGACCAGGAGGG - Intergenic
1159655119 18:71023974-71023996 TGGAATTCAAGCTGCAAGGTGGG - Intergenic
926799676 2:16649035-16649057 TGGAATTCAACCGACCAGGTTGG + Intronic
935724475 2:106011012-106011034 TGGAATTCAATCTGCCAGGCAGG + Intergenic
937332874 2:121043111-121043133 TGGAATCCAACTCACCTGGTGGG - Intergenic
941249352 2:163143667-163143689 TGGAATTCAACCTGCCGGGTGGG + Intergenic
941249943 2:163148788-163148810 TGGAATTCAATCTGCCAGGTGGG + Intergenic
948502869 2:238407734-238407756 TTGAATCCAACCAAGCAGGTGGG - Intergenic
1169731212 20:8787229-8787251 TGGAATTCAATCTGCAAGGTGGG - Intronic
1170753661 20:19176555-19176577 TGGAACTCAACCTAGCAGGTGGG + Intergenic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1176748562 21:10672861-10672883 TGGAATTAAACGGACCAGAATGG - Intergenic
1178504861 21:33154102-33154124 TGGAATTCAAACAAACATGTGGG + Intergenic
951642521 3:24852048-24852070 TGGAATTCCAGCAAGCAGGTTGG - Intergenic
952192906 3:31042807-31042829 TGGGATTCAAATGACCAGGCGGG + Intergenic
952448764 3:33410611-33410633 TGGAATTTAAACTACCAGGTAGG - Intronic
953138150 3:40201589-40201611 TGCAATTCCACCAACCAGGCAGG + Intronic
955845302 3:63156285-63156307 TGGAATTGAACTGACCACTTTGG - Intergenic
956282597 3:67573709-67573731 TGGGATTCAAACGGCCTGGTGGG + Intronic
959128393 3:102319519-102319541 AGGAATACAACCAACCAGGAAGG - Intronic
959820559 3:110730141-110730163 TGGAATTCAATTGGCCAGGAGGG + Intergenic
964081894 3:152768785-152768807 TGGAATTCAAACAACCAGAAAGG - Intergenic
965028202 3:163329119-163329141 TGGGATTCAAACGGCTAGGTGGG + Intergenic
965602582 3:170469632-170469654 TGGATTTCAGGCGACCAGGCAGG + Intronic
977352886 4:95910862-95910884 TGGGATTCAATCGGCCAGGCAGG - Intergenic
984414923 4:179446129-179446151 TGGAATTCAATCTGCAAGGTGGG - Intergenic
989768396 5:45113705-45113727 TGGAATAGAACCAAACAGGTAGG + Intergenic
990895837 5:60699714-60699736 TGGAATCTAACCGACCCGGTCGG - Intronic
997158957 5:131587028-131587050 TGGGATTCAATCTGCCAGGTGGG + Intronic
999007783 5:148001770-148001792 TGGAATTCAAACTGCCAGGCAGG + Intergenic
1001687698 5:173606840-173606862 TGGAACTGCACCTACCAGGTGGG + Intergenic
1003943932 6:11056376-11056398 TGGAATTCAACAGACCCTGTGGG - Intergenic
1009498954 6:64386702-64386724 TGGAATTTTAATGACCAGGTTGG - Intronic
1010368096 6:75076143-75076165 TGGAATTCAATCTGCCAGGTGGG - Intergenic
1010873009 6:81064665-81064687 TGGGATTCAATCTATCAGGTGGG - Intergenic
1012253308 6:97004191-97004213 TGGAATATAACCAACCAGGGAGG - Intronic
1013240658 6:108242558-108242580 TGGAATTCAGCCTACCACGCTGG - Intronic
1013271264 6:108547405-108547427 TGGAAGACAACTGACCGGGTTGG - Intergenic
1020677352 7:11197625-11197647 TGGGATTCAAACTGCCAGGTGGG + Intergenic
1030085551 7:105812350-105812372 TGGAAATCAACTGAACAGGTAGG - Intronic
1030139697 7:106291990-106292012 TGGGATTCAAACAGCCAGGTGGG + Intergenic
1035998548 8:4576214-4576236 TGGAATTCAGAAGACGAGGTGGG - Intronic
1037053483 8:14406568-14406590 TGGAACTCTACTGCCCAGGTGGG + Intronic
1040757994 8:50804365-50804387 TAGAATTCAAACTACAAGGTGGG + Intergenic
1042451675 8:68954763-68954785 TGGAATTCAATCTGCTAGGTGGG + Intergenic
1048682037 8:136853787-136853809 GGGAATTCAAACTACAAGGTTGG - Intergenic
1193631337 X:83892168-83892190 AGGAATACAACTGACCAGGTAGG - Intergenic
1193968582 X:88021312-88021334 AGGAATCTAACCCACCAGGTTGG + Intergenic
1194170531 X:90575214-90575236 TGGAGTTCATCCGAGCTGGTAGG + Intergenic
1199318662 X:146412007-146412029 AGGAATACAACTAACCAGGTAGG + Intergenic
1200516774 Y:4152974-4152996 TGGAGTTCATCCGAGCTGGTAGG + Intergenic