ID: 926800589

View in Genome Browser
Species Human (GRCh38)
Location 2:16656608-16656630
Sequence TCAGCAGCTCCTCCTCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 408}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926800589_926800590 26 Left 926800589 2:16656608-16656630 CCTCAGAGAGGAGGAGCTGCTGA 0: 1
1: 0
2: 7
3: 50
4: 408
Right 926800590 2:16656657-16656679 GAAATGTTAATCTTTTGATCTGG 0: 1
1: 0
2: 0
3: 20
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926800589 Original CRISPR TCAGCAGCTCCTCCTCTCTG AGG (reversed) Intronic
900626861 1:3612254-3612276 TTAGCGCCTCCTCCTGTCTGTGG - Intergenic
900666874 1:3821490-3821512 GCAGAAGCTCGTCCACTCTGTGG - Intronic
900893316 1:5465295-5465317 TCAGGAGCTCCTTTGCTCTGGGG + Intergenic
901169840 1:7248688-7248710 TCATCAGCCTCTCCTCTCTGTGG + Intronic
901229346 1:7633361-7633383 TCTGCAGCTCTTCCTCTCTGAGG - Intronic
901658440 1:10784004-10784026 TCAGCAGTGCCGCCTCGCTGGGG - Intronic
902574824 1:17371184-17371206 TCAGCTGCTACTCATCTCAGCGG - Intergenic
902847372 1:19122587-19122609 GCAGCAGTTCCTCCACTGTGAGG - Intronic
903034275 1:20484687-20484709 TCTGCGTCTCCGCCTCTCTGGGG + Intronic
903125366 1:21244090-21244112 TCAGCTCTGCCTCCTCTCTGGGG + Intronic
903287499 1:22285997-22286019 TCACCAGCAGCTCCCCTCTGGGG - Intergenic
903315038 1:22496713-22496735 TCAGCAATGCTTCCTCTCTGTGG + Intronic
903337500 1:22634967-22634989 TATGCACTTCCTCCTCTCTGAGG - Intergenic
904100760 1:28024967-28024989 ACAGCAGCCCATCCTCCCTGGGG - Intronic
904422995 1:30406030-30406052 TCAGCAGGTACTCCTGACTGGGG + Intergenic
904614610 1:31743082-31743104 TCAGGAGCTCCGCAGCTCTGCGG + Intronic
905238919 1:36570186-36570208 TGAGCTGCCCCTCCCCTCTGGGG - Intergenic
905512042 1:38529569-38529591 TTAGCAACTCCTCCTTCCTGAGG + Intergenic
905752923 1:40481593-40481615 GCAGCAGGTCCTCCTCACTAAGG + Intronic
906123971 1:43415144-43415166 TGAGCAGCTCTGCCTCTTTGAGG + Exonic
906188807 1:43882158-43882180 GCAGCATCTCTACCTCTCTGAGG - Intronic
907020501 1:51061914-51061936 GAAGCAGCTCATCATCTCTGAGG - Intergenic
907472188 1:54681044-54681066 TCAGGAGCTCCTCCTTGCGGGGG + Intronic
907761852 1:57368536-57368558 TCTCCAGGTCCTCCTCTCTGCGG + Intronic
908136944 1:61143001-61143023 CCAGGTGTTCCTCCTCTCTGAGG - Intronic
909353603 1:74681974-74681996 TCAGCCTATCCTCCTCACTGAGG + Intergenic
910723651 1:90314888-90314910 TCCGCAGATTCTCCTCCCTGTGG + Intergenic
911104922 1:94121996-94122018 TCAGCATCCATTCCTCTCTGTGG - Intergenic
912073117 1:105839206-105839228 TCAGCAGCCCCTCCTCTCACAGG + Intergenic
912118583 1:106439452-106439474 TCATCAGCTCCTCTGCTTTGCGG - Intergenic
912413524 1:109493491-109493513 TCAGCAGCTGCTCAGCCCTGAGG - Intergenic
913064506 1:115238206-115238228 TCACCAGCTCCTCACCTCTCAGG - Intergenic
915314232 1:155018869-155018891 TGAGCAACTCCTGCTCTCTCAGG + Intronic
915367336 1:155323559-155323581 GCAGCAGCTGCTCCTCTGGGGGG - Intronic
915540409 1:156562339-156562361 TCAAGAGCTGCTCCTCTCTATGG + Intronic
915661087 1:157405545-157405567 TCAGCAGCCGCCCCTCTCAGGGG - Intergenic
917962164 1:180154266-180154288 TCAGAAGCCCCTCTTCACTGTGG - Intergenic
918071528 1:181136913-181136935 TGAGCAGCTCCTCACCTCTGTGG + Intergenic
919808717 1:201396158-201396180 TCAGCTGCTCCTACTAGCTGAGG + Intronic
921271742 1:213476008-213476030 TCAGCAGTGCCTCATCTCTGCGG + Intergenic
921724257 1:218506933-218506955 ACAGCAGCACCCACTCTCTGTGG - Intergenic
922144229 1:222922686-222922708 TCTGCAGCTTCTACTCTCTAAGG - Intronic
922150683 1:223001057-223001079 TGAGTAGCCCCTCTTCTCTGAGG - Intronic
922578616 1:226680441-226680463 TCAGCATTGCCTCCTCTCTTGGG - Intronic
922863422 1:228838660-228838682 TAAGAAGCTCCTGCTATCTGAGG + Intergenic
923100384 1:230809551-230809573 TGAGCTGCTCCTCGTCCCTGGGG - Intergenic
923231001 1:231986216-231986238 TCCCCAGCTTCTCCTGTCTGGGG + Intronic
923454449 1:234151106-234151128 CCAGCAGCCCCTCCTCAGTGTGG - Intronic
923490276 1:234478410-234478432 CCAGCAGCTTCTCCTCTACGCGG + Exonic
1062946097 10:1463231-1463253 TCAGCAGTGTTTCCTCTCTGGGG + Intronic
1062988383 10:1791127-1791149 TCAGCAGCTTGTCCTGCCTGAGG - Intergenic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1063358596 10:5428109-5428131 CCAGCAGTTTCTCCTCACTGTGG + Intronic
1065479469 10:26177771-26177793 TCAGTGGCTCCTCCTGTCTTTGG - Intronic
1066541049 10:36447189-36447211 CCAGCAGCTCCTCCCTTCTCTGG + Intergenic
1067812352 10:49439509-49439531 ACAGCAGCTCCTCCTATCACAGG - Intergenic
1068492371 10:57739616-57739638 TCATTAGCTCGTTCTCTCTGAGG - Intergenic
1069957608 10:72061516-72061538 TCGGCAGCTGCTTCTCTCCGGGG + Exonic
1069963244 10:72091290-72091312 GCAGCAGCTCCTCATGTTTGGGG - Intergenic
1070546730 10:77458349-77458371 TGGGCAGGTCCTCCTCCCTGAGG + Intronic
1070572051 10:77647337-77647359 TCGCCAGCTCTTTCTCTCTGAGG + Intergenic
1071035519 10:81239357-81239379 ACAGCAGCTCCTCCTATCACAGG - Intergenic
1071470184 10:85978732-85978754 TCAGCAGGCCTTCCTCACTGGGG - Intronic
1071598312 10:86943598-86943620 ACTGCAACTCCTCCTCCCTGCGG + Exonic
1072335587 10:94395462-94395484 TGAGCACTTCCTCCCCTCTGAGG - Intergenic
1072637593 10:97187624-97187646 TCACCAGCTCCTGCTCCATGGGG + Intronic
1074327792 10:112469830-112469852 TCTGGAGCTCCTTCTCTTTGTGG + Intronic
1075019885 10:118944059-118944081 TGGGCAGCTCCACCTCCCTGGGG + Intergenic
1075447006 10:122519978-122520000 TCAGCCCCTCCTCGTGTCTGAGG + Intergenic
1075447021 10:122520058-122520080 TCAGCCACTCCTCGTGTCTGAGG + Intergenic
1075447034 10:122520138-122520160 TCAGCCTCTCCTCATGTCTGAGG + Intergenic
1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG + Intergenic
1076243812 10:128930777-128930799 ACAGCAGCTCCTGCTTGCTGGGG - Intergenic
1076351112 10:129815920-129815942 CCAGCACCCCCTCCCCTCTGGGG + Intergenic
1076581247 10:131513418-131513440 TCAGCAGCTCCTGCTGGCTCTGG - Intergenic
1076680709 10:132169863-132169885 TTCGCACCTCCTCCTCGCTGCGG - Exonic
1076763893 10:132620156-132620178 GCAGCAGCTCCTCCTGTCACAGG - Intronic
1076775858 10:132697682-132697704 TCATCAGGGCCTCCTCTCGGGGG + Intronic
1077107075 11:846799-846821 GCAGCAGTGCCTCCTCCCTGGGG - Intronic
1077541855 11:3150417-3150439 CCAGCAGCTCCTCCTCCTTAGGG + Intronic
1077613656 11:3660224-3660246 TCAGCACCTCTTCCTCTCCAGGG - Exonic
1078039717 11:7848765-7848787 GCTGCAGCTCCCCCTCTTTGTGG + Intergenic
1079089771 11:17472719-17472741 TCAGCAGCCCCTCCTGTGTGTGG - Intronic
1081615901 11:44591097-44591119 TCAGCACCTTCTCCTCCCTCGGG + Intronic
1082185333 11:49173398-49173420 ACAACAGCTGCTCCACTCTGAGG + Exonic
1082789275 11:57335883-57335905 TAGCCAGCTCATCCTCTCTGTGG - Intergenic
1083392922 11:62368045-62368067 ACAGTAGCTCCCCCTATCTGCGG + Intronic
1083587138 11:63868582-63868604 TCAGCAGTGCATCCTCCCTGTGG - Intronic
1083602018 11:63954637-63954659 TCAGCTGCTCCTCCTCTCCTAGG + Exonic
1084129022 11:67119302-67119324 TCAGCGGCTCCTCCTGTGTGAGG + Intronic
1084195693 11:67522789-67522811 TCACCAGCTGCTCCTGTCTTTGG + Intronic
1084548348 11:69825704-69825726 GCTGCAGCCCCTCATCTCTGGGG + Intergenic
1086455620 11:86956096-86956118 TCTGCAGCTCCGCAGCTCTGGGG - Intergenic
1086510108 11:87547566-87547588 CCATCAGCTCCTCTTCTCTTTGG + Intergenic
1086583452 11:88425283-88425305 ACAGCAACTGCTACTCTCTGAGG + Intergenic
1086680990 11:89671943-89671965 ACAACAGCTGCTCCACTCTGAGG - Intergenic
1089092742 11:115891851-115891873 TAAGCAGCTAATCCTCTCTGGGG + Intergenic
1089367336 11:117929077-117929099 CCAGCAGCTTCTCCTCCCAGGGG + Intronic
1089457427 11:118633762-118633784 TGATTAGGTCCTCCTCTCTGGGG + Intronic
1090404622 11:126469334-126469356 CCAGCTTCTCTTCCTCTCTGCGG + Intronic
1090695541 11:129237765-129237787 TCAGTAGCTCCTCATTTCAGGGG - Intronic
1091219610 11:133922315-133922337 TGAGCAGCTCCTTCCCTGTGCGG - Intronic
1091297155 11:134482079-134482101 TCAGCCACTCCTCCAGTCTGGGG + Intergenic
1091399493 12:173624-173646 TGAGACCCTCCTCCTCTCTGAGG - Intronic
1091410757 12:237640-237662 TCCGCACTTCCTCCTCCCTGTGG - Intronic
1091693988 12:2615966-2615988 TCAGCTGCTTCACCCCTCTGCGG - Intronic
1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG + Intronic
1092782089 12:11996644-11996666 TCAGCCACTCCCCCTCCCTGAGG + Intergenic
1093710987 12:22329724-22329746 TCAGCAGTTCCACCTTTATGTGG - Intronic
1096616596 12:52836547-52836569 GCAGCAGCTCTTCCTCTCTGTGG - Intergenic
1096751032 12:53759025-53759047 TCAGCGTCTTCTCCTCTCTCTGG + Intergenic
1097044348 12:56176326-56176348 TCCACAGCTTCCCCTCTCTGGGG - Intronic
1097081321 12:56433305-56433327 TCAGCATCTCCTCCTCTGCCCGG + Intronic
1098035111 12:66293807-66293829 TCCCCAGCTCCATCTCTCTGTGG + Intergenic
1098936872 12:76490412-76490434 CCAGCAGCTTCTCCTCTCTTCGG - Intronic
1100898829 12:99215422-99215444 TCAGTGGCTCTACCTCTCTGAGG - Intronic
1101210433 12:102530084-102530106 TTAGCTGCTTCTCCTCCCTGGGG - Intergenic
1101858793 12:108465622-108465644 TCAGCATCTCCTCCTAGCTTGGG + Intergenic
1102143220 12:110634037-110634059 GAAGCAGCTCCTCCTTTCTTGGG - Intronic
1103620528 12:122184569-122184591 TCACCACATCCTCCTCTCTGGGG - Exonic
1105028410 12:132865452-132865474 TCAGGTGATCCTCCTCTCTCAGG + Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1105733631 13:23245554-23245576 ACAGGAGCTGCTCATCTCTGGGG - Intronic
1107960062 13:45549541-45549563 TCACCAAACCCTCCTCTCTGAGG + Intronic
1108090979 13:46849475-46849497 TCAGCAGAGCCACATCTCTGAGG - Intronic
1111999059 13:95193291-95193313 TGACCAGCTCCTCCCCTCTCCGG - Intronic
1112892474 13:104255255-104255277 CCAGCAGGTCCTCCTCCCTCTGG - Intergenic
1113066951 13:106382410-106382432 TCAGCACCTCCTTGTCCCTGCGG - Intergenic
1113185005 13:107678220-107678242 TCACCATGTCCTCCTGTCTGTGG - Intronic
1113386609 13:109854562-109854584 CCACCAGCTTCTCCTCTTTGTGG + Intergenic
1114416274 14:22546644-22546666 CCAGCAGCTCCTGCTTTCTGAGG + Intergenic
1115116907 14:29891532-29891554 TCAGCACCTCCTCTTCTGTGAGG + Intronic
1117106787 14:52405559-52405581 GCAGCAGCTCCTTCTCTTGGGGG - Intergenic
1117714040 14:58562750-58562772 CCCCCAGCTGCTCCTCTCTGAGG - Intergenic
1118708861 14:68503384-68503406 TCAGCTGTTTCTCCTCCCTGAGG - Intronic
1118747332 14:68783896-68783918 TCATGAGCTCCTTCTCCCTGAGG + Intergenic
1118903397 14:70005065-70005087 TCAGCAGTTCCTCCTCTGGAAGG + Intronic
1121727893 14:96166351-96166373 GTGGCAGCTCCACCTCTCTGGGG - Intergenic
1121788829 14:96683572-96683594 TAAGCATTTCCTTCTCTCTGTGG + Intergenic
1122907869 14:104810516-104810538 TCACACCCTCCTCCTCTCTGCGG + Intergenic
1123159719 14:106266761-106266783 TCAGCAGCTTTGCCTCTCTCTGG + Intergenic
1123175022 14:106408810-106408832 TCAGCAGCTTCGCCTCTCTCTGG + Intergenic
1123201807 14:106673338-106673360 TCAGCAGCTTCACTTCTCTCTGG + Intergenic
1202943663 14_KI270726v1_random:6971-6993 TCAGCAGCTTCGCCTCTCTCTGG - Intergenic
1124199071 15:27660888-27660910 TCAGCAGCTGCTGCCCTTTGAGG - Intergenic
1124494818 15:30179941-30179963 TTGGCAGCTACTTCTCTCTGAGG - Intergenic
1124748751 15:32358704-32358726 TTGGCAGCTACTTCTCTCTGAGG + Intergenic
1124841283 15:33244437-33244459 AAAGCATCTCCTTCTCTCTGTGG + Intergenic
1129296119 15:74601059-74601081 GCAGCAGCTCCCACTCCCTGAGG + Intronic
1129542822 15:76364807-76364829 TTAGGGGCTCCTCATCTCTGAGG + Intronic
1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG + Exonic
1130377936 15:83346676-83346698 CCATCAGCTCCTCCTCTCTGGGG + Intergenic
1130550770 15:84888806-84888828 CCAGCTGCTCCTGATCTCTGCGG - Exonic
1131294699 15:91136727-91136749 TCACCACCCCCTCCTCCCTGAGG - Intronic
1131405488 15:92160855-92160877 ACAGCAGCACCTCCATTCTGTGG - Intronic
1131446585 15:92503106-92503128 AGAGCAGCTGCTCCACTCTGTGG - Intergenic
1131513205 15:93060970-93060992 TCTCCAGCTGCTCCTCTCTTTGG + Intronic
1131938534 15:97534827-97534849 GCAGCAGCTTCTCCACTCTTTGG - Intergenic
1132697161 16:1207164-1207186 ACGGCACCTCCACCTCTCTGGGG - Intronic
1133259700 16:4540275-4540297 TCAGCATCGCCTCCTCTGAGAGG - Intergenic
1133753117 16:8740137-8740159 TCAGCCGCTCATCAGCTCTGTGG - Intronic
1134090149 16:11387195-11387217 GCAGCAGCTTCTCCTCCATGAGG + Exonic
1134513841 16:14870769-14870791 TCAAATGCTCCCCCTCTCTGTGG + Intronic
1134701484 16:16269264-16269286 TCAAATGCTCCCCCTCTCTGTGG + Intronic
1134970347 16:18525381-18525403 TCAAATGCTCCCCCTCTCTGTGG - Intronic
1135190439 16:20349806-20349828 TCAGTGTCGCCTCCTCTCTGCGG + Exonic
1136476686 16:30517908-30517930 ACAGCAGCTCCACATCTCTTAGG - Intronic
1136565144 16:31065352-31065374 ACACCAGCTCATCCTCCCTGGGG + Intronic
1136604303 16:31322547-31322569 TCAGCAGCTCCTCAGTGCTGGGG + Intronic
1137855758 16:51793009-51793031 TAAGCAGTTCCTCTTCTATGTGG + Intergenic
1138182365 16:54950161-54950183 TCTGCAGCTCATCCTCGGTGGGG - Intergenic
1138624095 16:58235716-58235738 CCAGCACCTCCTCCTCTGAGAGG - Intronic
1139430281 16:66907455-66907477 TCTGGAGCTGCCCCTCTCTGAGG - Intergenic
1139521174 16:67483477-67483499 GCAGGGACTCCTCCTCTCTGTGG - Intronic
1140709002 16:77658824-77658846 TGAGCAGCTTCTCACCTCTGGGG + Intergenic
1140778353 16:78271618-78271640 TCAGAGGCTCCACCTCACTGGGG - Intronic
1140854322 16:78964734-78964756 ACAGCAGCCCCTCCTATCAGAGG + Intronic
1141024064 16:80527502-80527524 TCAGCACCCCCGCCTCACTGAGG - Intergenic
1142005459 16:87687702-87687724 TCAGCAGCTCATTCTAGCTGAGG + Intronic
1142106278 16:88304596-88304618 CCAGCTGCTTCTGCTCTCTGTGG + Intergenic
1142750190 17:1982852-1982874 TCAGCCGCTGCCCCTCCCTGAGG - Intronic
1142780939 17:2180661-2180683 ACAGCATCTTCCCCTCTCTGAGG - Intronic
1144377387 17:14657711-14657733 AAAGCAGCCCCTCCTCTCTATGG - Intergenic
1144451940 17:15388446-15388468 TGATCAGCCCCTCCTCTCTTGGG - Intergenic
1144738735 17:17569379-17569401 TGTGCAGCTCCTCCCCTCTGAGG - Intronic
1144788291 17:17843914-17843936 TCACCAGCCCTTCCTATCTGTGG - Intronic
1146681941 17:34814876-34814898 TGAACATCTCTTCCTCTCTGTGG - Intergenic
1146689608 17:34864198-34864220 TTACCAGCTGCGCCTCTCTGTGG - Intergenic
1147176447 17:38658957-38658979 GCAGCAGCACCTCCTCTCTGGGG - Intergenic
1147258401 17:39195435-39195457 TTGGCAGTTCCTCCTCTCTGGGG - Intronic
1147789893 17:43007151-43007173 TAATGAGCTCCTCCTGTCTGAGG - Intronic
1147978845 17:44262596-44262618 TCAGCAGCTCATCCCAGCTGAGG + Intronic
1148184941 17:45635854-45635876 GCAACAGCTCCCCCTCTCTCAGG - Intergenic
1148845456 17:50527313-50527335 TCATCAACGCATCCTCTCTGTGG - Exonic
1148994537 17:51698069-51698091 CCAGCAGCTGCTGCCCTCTGTGG + Intronic
1150982424 17:70157374-70157396 AGAGCAACTTCTCCTCTCTGTGG + Intergenic
1151368291 17:73631065-73631087 CCAGAAGCGCCTCCTCTCTGGGG + Intronic
1151535859 17:74738408-74738430 ACAGCAGCTCCTCCTCTCCGAGG - Intronic
1151546365 17:74795724-74795746 AGAGTAGATCCTCCTCTCTGGGG - Intronic
1152000033 17:77639548-77639570 GCAGCATCTCCTCCTGCCTGGGG + Intergenic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1152230918 17:79113664-79113686 TCAGCAGCTGCTGCTCACTCGGG + Intronic
1152456244 17:80418058-80418080 TCAGCAGCCCCTACTCTAAGAGG + Intronic
1152495713 17:80669772-80669794 CCAGGAGCTCTTCCCCTCTGTGG + Intronic
1152614215 17:81330475-81330497 CCAACAGCGCCTCCTCTGTGAGG - Exonic
1152815082 17:82403130-82403152 TCAGCCACTCATGCTCTCTGTGG - Intronic
1153158733 18:2179232-2179254 TCATCACTTCCTCCCCTCTGTGG - Intergenic
1153265068 18:3261988-3262010 TCAGCAGCCCCGCCGCTCGGCGG + Intronic
1153675740 18:7454594-7454616 TCTGCAGCACCTCCTCAATGTGG + Intergenic
1154076235 18:11204727-11204749 CCAGCTGCTCCTCTGCTCTGAGG + Intergenic
1154199353 18:12288452-12288474 GCTGCAGCTCGTCCTCTCTCAGG - Intergenic
1155120650 18:22816107-22816129 TCTCCAGGGCCTCCTCTCTGGGG - Intronic
1155330196 18:24707825-24707847 TCAGAAGGCCCTCCTCTTTGAGG + Intergenic
1155845730 18:30703725-30703747 CCATCTGCTCCTCCTCTCTATGG - Intergenic
1156269171 18:35515288-35515310 TTGGCAGCCTCTCCTCTCTGGGG + Intergenic
1158200924 18:54939651-54939673 TAAGAAGCTCCTCCTATCTATGG + Intronic
1160848042 19:1175172-1175194 TGAGGGGCTCCTCCTCTCGGTGG + Intergenic
1161794894 19:6380929-6380951 GCAGCACCTCCTCCACCCTGCGG - Exonic
1162117745 19:8441802-8441824 CAATCAGCTCCTCCACTCTGAGG - Intronic
1163403016 19:17105765-17105787 TCAGTTCCTCTTCCTCTCTGAGG + Intronic
1164042461 19:21505797-21505819 CCAGCCCCTCCCCCTCTCTGGGG - Intronic
1164446110 19:28318841-28318863 TTCTCAGCTCCTCTTCTCTGGGG - Intergenic
1164537943 19:29100319-29100341 TTAGCAGCTCCTTCTCTTTGTGG + Intergenic
1164590615 19:29504958-29504980 TCTGCAGCTGCTTCTCTCTGTGG + Intergenic
1165363675 19:35351463-35351485 CCAGGAGCCCCTCCTCTCCGGGG + Intergenic
1165365808 19:35363911-35363933 CCAGGAGCCCCTCCTCTCTGGGG + Intergenic
1165436826 19:35800091-35800113 TGAGCAGCTCCTGTTCCCTGCGG + Exonic
1167223000 19:48215339-48215361 TCAGCCCCTCCTCCTTTCTCAGG - Exonic
1167712320 19:51119984-51120006 TCACCAGCTCCTGCACTCTAAGG - Intergenic
1167775528 19:51552158-51552180 TCTACAACTCCTCCCCTCTGTGG + Intergenic
1168415699 19:56166839-56166861 TCCCCAACCCCTCCTCTCTGGGG + Intergenic
925983869 2:9199234-9199256 TCAGCTGCTCCTCCTCATTCTGG + Intergenic
926144021 2:10385906-10385928 TCCGGAGCCTCTCCTCTCTGGGG + Intronic
926416480 2:12654652-12654674 TCAGCAGTTCCTGCTGTCTCAGG - Intergenic
926800589 2:16656608-16656630 TCAGCAGCTCCTCCTCTCTGAGG - Intronic
926920135 2:17931986-17932008 TCTGCTTCTCTTCCTCTCTGTGG + Exonic
927827376 2:26318007-26318029 TCACCAACTCCTCCTCTGTCAGG + Exonic
927883750 2:26706294-26706316 TCTCCAGCTCCTCCTCTGGGGGG - Intronic
928088162 2:28358546-28358568 TGGGCTGCGCCTCCTCTCTGAGG - Intergenic
928704954 2:33939610-33939632 TCAGCAGCTGCTTCTTTCTTGGG + Intergenic
930280481 2:49362921-49362943 ACAGCAGCTCCTCCTATCACAGG - Intergenic
931620578 2:64205839-64205861 GCAGCAGCTCTTCCTCTCCAGGG + Intergenic
932336329 2:70933284-70933306 GCTGCAGCCCCTCCTCTCCGGGG - Exonic
932490455 2:72116562-72116584 TCAGCAGCTCCTCCCCATTCTGG + Intergenic
932763708 2:74457414-74457436 TCAGCAGCATCTCCTCTGTGAGG - Exonic
932784058 2:74584253-74584275 TCAGCAGCTTCTCTTCAGTGAGG + Intronic
933592559 2:84248855-84248877 ATAGCAGCTCCTCCACTCTTAGG + Intergenic
934656461 2:96118954-96118976 TCAGCTCCTGCTCCTCTCGGCGG + Intergenic
934974401 2:98790463-98790485 TCAGCAGATCCCACTCTCAGTGG + Intergenic
934979608 2:98829186-98829208 ACAGCAGGACCTCCTCCCTGTGG + Intronic
937306173 2:120872370-120872392 GCAGCAGCCACTCCTCACTGGGG - Intronic
937380155 2:121369046-121369068 TCAGCAGTTCCACTTATCTGAGG - Intronic
938256188 2:129861720-129861742 GCAGCAGCTGCTACTCACTGGGG - Intergenic
940049708 2:149449246-149449268 TCAGCTGCTCCTCTTGTCTAAGG + Intronic
940716661 2:157233543-157233565 TCAGCCGCTCAGCCTCACTGTGG + Intergenic
941110507 2:161415321-161415343 TCTGCATTTCCTTCTCTCTGAGG - Intergenic
942763692 2:179429238-179429260 ACAGCAGCTCCACCTGTTTGGGG + Intergenic
944639082 2:201704222-201704244 TCAGCATCTTTTTCTCTCTGGGG - Intronic
946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG + Exonic
947949663 2:234136192-234136214 TCAAGAGCTCTTCCTCCCTGAGG - Intergenic
948268470 2:236656376-236656398 TCAGCAGCACCCCTTCCCTGAGG + Intergenic
948671696 2:239572692-239572714 TCAGAATCTCCTCCTCTGAGAGG + Intergenic
948722786 2:239912019-239912041 AAAGCTGCGCCTCCTCTCTGGGG - Intronic
949088895 2:242182479-242182501 TCAGCAACCCCTCCCCTCCGGGG + Intergenic
1171324100 20:24275695-24275717 GCAGCATCTGCCCCTCTCTGTGG - Intergenic
1171400367 20:24869121-24869143 TCAGCACTTCCTCCTCTGTGTGG - Intergenic
1171473174 20:25388479-25388501 CCATCACCTCCTCCTCACTGAGG - Intronic
1172038281 20:32025787-32025809 TCAGCATCCCCTGCTCCCTGAGG - Intronic
1173014585 20:39213610-39213632 TCAGCAGTACCTCCGCTCTATGG + Intergenic
1174171863 20:48622678-48622700 TCAGCCTCTCCTCCACCCTGGGG - Intergenic
1175384204 20:58583826-58583848 TCAGCAGCTCGACCCCTCTGAGG - Intergenic
1175502517 20:59460524-59460546 GCAGCAGCTCCTCCAGCCTGAGG + Intergenic
1175532648 20:59684723-59684745 TCAGCAGATCCTCCTCTCTAGGG - Intronic
1175781303 20:61683989-61684011 CCAGGAGCTCCTCGTGTCTGGGG + Intronic
1176843358 21:13858092-13858114 TCAGCAGCTCACACCCTCTGTGG + Intergenic
1177438141 21:21082860-21082882 TGAGGAGCTCTTCCACTCTGCGG + Intronic
1178821250 21:35977135-35977157 TCAGCTGCTCCTCCTCTTGGTGG - Intronic
1180159104 21:45991155-45991177 CCACCAGCTCCTCCCCTCTGAGG - Intronic
1180998998 22:19979264-19979286 TCTGCACCTCCTCCCCTTTGGGG - Intronic
1181282641 22:21730804-21730826 CCACCAGCCCCTGCTCTCTGGGG + Intronic
1181309771 22:21938291-21938313 GCTGCTGCTCCTCCGCTCTGCGG - Intronic
1181345291 22:22215691-22215713 CCAGCAGCCCCTCCCTTCTGTGG + Intergenic
1181345754 22:22219566-22219588 TGACCAGCTCCTCCTCGCTGAGG + Intergenic
1182074159 22:27483652-27483674 TCTCCAGCATCTCCTCTCTGCGG - Intergenic
1182294291 22:29304123-29304145 TCAGCATATCCACTTCTCTGGGG - Intergenic
1182718161 22:32376588-32376610 TCTGTAACTCCTCCTCTGTGAGG + Intronic
1183114249 22:35677662-35677684 TCAGCAGCTACCCAGCTCTGTGG + Intergenic
1184188278 22:42878750-42878772 TCATCAGCTCCTCCCCACTCAGG + Intronic
1184782939 22:46658179-46658201 TCCGGAGCTCCTCCTCTATGGGG - Exonic
1184830629 22:46984026-46984048 TCAGCCCCTCCCTCTCTCTGGGG + Intronic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
950033304 3:9866097-9866119 TGAGAAGCTCCTACTCTTTGGGG + Intergenic
950054870 3:10016411-10016433 TGAGAAGCTCCTACTCTTTGGGG + Intergenic
950136026 3:10581486-10581508 TCTGCAGTTCCTCATCACTGTGG - Intronic
950764041 3:15260181-15260203 TCAGCTGCTCTTCATCCCTGGGG - Intronic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
952885104 3:38007222-38007244 TCAGCAGGTCCACCTCTCAGGGG + Intergenic
953236302 3:41110471-41110493 CCATCATCTCCTCCACTCTGAGG - Intergenic
953424324 3:42780867-42780889 GCAGCAGTTCCTCATCTCTGAGG + Intronic
953851698 3:46469903-46469925 ACAGAAGCTCCTTGTCTCTGTGG - Intronic
954425842 3:50442747-50442769 TCAGTAGTTGCTTCTCTCTGGGG - Intronic
954881037 3:53836213-53836235 GCAGCTGCTCCTCCTCTCTCAGG + Intronic
955397468 3:58567231-58567253 TCAGCAGCTCCTGCTCAAAGGGG + Exonic
960068526 3:113402454-113402476 TCAGCAGGACCTCCCCTGTGAGG + Intronic
960821595 3:121738733-121738755 TCAGCAGATTCTCCTCAGTGTGG - Intronic
960962434 3:123081807-123081829 TAAAAAGCTCCTCATCTCTGGGG - Intronic
961127739 3:124435722-124435744 TCTGCAGCTCCTCACTTCTGTGG - Intronic
961478108 3:127161165-127161187 GCAGCAGCTCTTCCCCTATGTGG - Intergenic
961529931 3:127534203-127534225 TGAGGAGCACCTCCTCTCTGTGG + Intergenic
962628138 3:137248164-137248186 GCAGCAGCCCCACCTCCCTGGGG - Intergenic
963275907 3:143329704-143329726 TCAGCAGTTCCTCCTTTTGGAGG + Intronic
963815061 3:149820572-149820594 TAAGCAGCTCTTCCTCTTTGAGG - Intronic
966538094 3:181056697-181056719 TGGGCAGCTTCTTCTCTCTGCGG - Intergenic
967950763 3:194838495-194838517 TGAGCAGATGCTCCTCTCTCGGG + Intergenic
968136042 3:196220190-196220212 TCACGAGCTCCTTCTCGCTGCGG - Intronic
968644886 4:1735477-1735499 TCTGCAGCACCTCCTCTAAGTGG + Intronic
968891956 4:3374215-3374237 TCGGCAGCTCCTGCTGTCTGCGG - Intronic
969524932 4:7699570-7699592 TCAGCAGCCCCATCTCTCTCGGG + Intronic
969696658 4:8738777-8738799 TCCACAGCTGCTCCTCTCTGGGG - Intergenic
970100425 4:12515085-12515107 TCAGCAGCTCCCCCTCACTGTGG - Intergenic
970907658 4:21235845-21235867 GCAGTACTTCCTCCTCTCTGAGG - Intronic
972309055 4:37863192-37863214 TCAGCTGCTCCTCATCCCTAAGG - Intergenic
973091805 4:46146794-46146816 TCAGGAGCTCCTACTCTTAGGGG - Intergenic
973807966 4:54543959-54543981 GCAGCAGCTTCTGCTCTCTGCGG + Intergenic
974524865 4:63036735-63036757 TGAACAGCACCTCCTCACTGAGG + Intergenic
976172378 4:82317849-82317871 TCAGCAGCTCCTCCAATCACAGG + Intergenic
976820103 4:89196482-89196504 TCACAAGCTCCTCCTTCCTGAGG + Intergenic
977182244 4:93890661-93890683 TCAGCTGATCCACCTCTTTGTGG - Intergenic
977266074 4:94856411-94856433 TCAGCTGCTCCCCCTCTCCCAGG - Intronic
981407311 4:144386327-144386349 ACAGCAGCACCCCTTCTCTGTGG + Intergenic
981465572 4:145067687-145067709 TCAGCAGATGCTCGTATCTGTGG - Intronic
983665439 4:170176823-170176845 TCAGCAGCTCCTCCCATCACGGG + Intergenic
983991688 4:174127696-174127718 TCAGCTGCTGCTGATCTCTGAGG + Intergenic
984752052 4:183287404-183287426 TAAGCAGCTCATACTCTCAGGGG + Intronic
985441228 4:189983706-189983728 ACAGCAGCTTCCCCTCTCTTAGG + Intergenic
985936900 5:3104357-3104379 TCAGCCGCTCCTCATCTAAGAGG + Intergenic
986521803 5:8627325-8627347 GCATCTGCTTCTCCTCTCTGTGG + Intergenic
987317383 5:16736350-16736372 TCAGTTGCTCCTGCTATCTGGGG - Intronic
987759443 5:22141490-22141512 CCACCACCTCCTCCTCTCTAAGG - Intronic
988034182 5:25804048-25804070 TCAGCAGATCTACCACTCTGGGG + Intergenic
991025968 5:62030099-62030121 TTAGCATTTCCTTCTCTCTGAGG + Intergenic
991215628 5:64155145-64155167 CCAATAGCTCCTCCTCCCTGGGG - Intergenic
991227774 5:64292754-64292776 TCAGCAGCCCCTCCCCCATGGGG + Intronic
991894165 5:71374920-71374942 CCACCACCTCCTCCTCTCTAAGG - Intergenic
992407368 5:76472368-76472390 TCAGCACCAACACCTCTCTGAGG - Intronic
992615194 5:78540741-78540763 ACAACAGCTCCTCCTCCTTGGGG + Intronic
993864332 5:93174403-93174425 CCACCAGCTCCTCCTTTCTATGG + Intergenic
995243437 5:109911239-109911261 TCCTCAGCTCCTCCTTTCTGGGG + Intergenic
995625339 5:114070231-114070253 TTGCCAGTTCCTCCTCTCTGAGG + Intergenic
996304831 5:122035224-122035246 GCAGCAGCCCCTCCTCTTTCAGG + Intronic
996497332 5:124174763-124174785 ACAGCAGCTCCTCCTATCACAGG - Intergenic
997283938 5:132665099-132665121 TCAGCAGCTCTGCCTCTCTTGGG + Intergenic
997412226 5:133699109-133699131 TCACCAGCCCCTCCTTTCTGAGG + Intergenic
997415028 5:133721029-133721051 AAACCAGCTTCTCCTCTCTGTGG + Intergenic
998467732 5:142358919-142358941 TCTGCAGTTCCTCAACTCTGAGG + Intergenic
998908993 5:146937508-146937530 TCAAAAGCCCCTCCTCTCTGTGG - Intronic
999245663 5:150153220-150153242 TCAGCAGCCCCCCTCCTCTGCGG - Intronic
999259303 5:150228168-150228190 TGAGCAATTCCTTCTCTCTGTGG - Intronic
1000338510 5:160259667-160259689 TCAGCAGCTCCTTCTTGGTGAGG + Exonic
1003023286 6:2530538-2530560 TCTGCAGCTCCTTTGCTCTGAGG - Intergenic
1003133196 6:3413243-3413265 ACAGCACCTCTTTCTCTCTGGGG - Intronic
1004188260 6:13440915-13440937 GCAGCAGTTCCTTCTGTCTGTGG - Intronic
1004326144 6:14675632-14675654 TCAGCAGCTGGTCCTCACTTTGG + Intergenic
1006154520 6:32007066-32007088 TCAGCTGCTTCTCCTCGTTGTGG - Intergenic
1006851543 6:37102405-37102427 ACATCAGCTGCTCCTCCCTGGGG - Intergenic
1007249253 6:40484488-40484510 TCAGGATCTGCTCTTCTCTGGGG - Intronic
1007726614 6:43920686-43920708 TTAGCAGCTCCTCCCTTCTCAGG + Intergenic
1008930422 6:56933062-56933084 TCCTCAGTTCCTCCTATCTGAGG - Intronic
1009039715 6:58161659-58161681 TCAGGACCTCCTCCTTTCTAGGG - Intergenic
1009215608 6:60916504-60916526 TCAGGACCTCCTCCTTTCTAGGG - Intergenic
1010727926 6:79356246-79356268 AGAGCAGCTCCTCCACTCTGCGG - Intergenic
1011190776 6:84725969-84725991 TCAGCATCTCCTCATCTAGGAGG + Intronic
1016512912 6:144863761-144863783 TCAGCAGCTCCTCCCATCACAGG + Intergenic
1016990093 6:149922726-149922748 TGACCAGCTCCTCCCCTCGGAGG + Intronic
1019922554 7:4172192-4172214 CCAGCAGCTGTCCCTCTCTGAGG - Intronic
1022127866 7:27375519-27375541 TAGACATCTCCTCCTCTCTGGGG + Intergenic
1022847520 7:34225960-34225982 CCTTCAGCTCCTGCTCTCTGTGG + Intergenic
1023855783 7:44182910-44182932 TCTGCAGCTGCTGCTCACTGCGG - Intronic
1023989326 7:45118804-45118826 TCATCAGCTCCTCACCTCTCAGG - Intergenic
1024557092 7:50613262-50613284 GCAGCAGCCCCTCCTCTCAGTGG - Intronic
1024828062 7:53415856-53415878 TTAGCAGTTCCTCCACTCTCTGG + Intergenic
1027221701 7:76218238-76218260 TCAGAAGCCCATGCTCTCTGAGG - Intronic
1029115310 7:98233545-98233567 CCACCAGCCTCTCCTCTCTGGGG - Exonic
1029551117 7:101237612-101237634 TCTGCCCCTCCCCCTCTCTGGGG - Exonic
1029662039 7:101968845-101968867 TCAGCAGCTGATCAGCTCTGTGG + Intronic
1034449753 7:151130945-151130967 TGAGCAGCCGCTTCTCTCTGGGG + Intronic
1034470760 7:151253250-151253272 TCAGCACCCCCTCCTCTATGGGG + Intronic
1035129807 7:156641012-156641034 TCCACAGCTCCTTCTATCTGAGG + Intronic
1035386326 7:158475298-158475320 TCCCCAGCTCCCCCTGTCTGGGG + Intronic
1035642379 8:1193896-1193918 CCAGCGGCTCCTCCTGGCTGGGG - Intergenic
1035743314 8:1944870-1944892 TTAGCAGCTCCTGCTGGCTGTGG + Intronic
1036374820 8:8191195-8191217 TCAGCTGCAACTCCTTTCTGAGG - Intergenic
1036503024 8:9330738-9330760 CCAGCAGCTCCCCGTCTCTGCGG + Intergenic
1036823894 8:11961429-11961451 TCAGCTCCTCCTCCTATTTGAGG - Intergenic
1036854724 8:12231957-12231979 TCAGCTGCAACTCCTTTCTGAGG + Intergenic
1036876082 8:12474449-12474471 TCAGCTGCAACTCCTTTCTGAGG + Intergenic
1036991742 8:13605708-13605730 TCAGCAGGTCCCACTTTCTGAGG - Intergenic
1037805734 8:22057152-22057174 TCCGCCTCTCCTCCCCTCTGTGG + Intronic
1037987979 8:23301523-23301545 TCTGCAGATCCTCCTCTATGAGG + Intronic
1039936825 8:42052340-42052362 GCACCAGCTCCTCCTCTCCCGGG - Intergenic
1040880523 8:52199916-52199938 TGAGCAGCTCCTTCTGGCTGGGG - Intronic
1041530336 8:58858542-58858564 TCACCAGCTGCTGCTTTCTGTGG + Intronic
1041948719 8:63476100-63476122 TCAGCTTTTCCTCCTCTCTCTGG + Intergenic
1044392138 8:91663612-91663634 ACAGCAGCTGTTCCTCCCTGTGG - Intergenic
1045555140 8:103208427-103208449 TCAGCAGCTCCTCCTATCCCCGG - Intronic
1045653409 8:104363941-104363963 CCAGCAGCTTCACCTCTCAGTGG + Intronic
1045888579 8:107127626-107127648 ACAGCAGCCCCTCCCCTCAGAGG - Intergenic
1046596141 8:116263626-116263648 TGAGTTGCTCCTCCTGTCTGTGG + Intergenic
1047064973 8:121271707-121271729 GCATCATCTCCTCCTCTCTTTGG - Intergenic
1047433609 8:124815735-124815757 TCAGTAGCTCCTCCTCTGTTGGG + Intergenic
1048288161 8:133158515-133158537 TCAGCAGATCTTCCCCTCTGAGG - Intergenic
1049290567 8:141799606-141799628 GCCGCAGGTCCTCCTCTGTGGGG - Intergenic
1049373419 8:142278281-142278303 TCAGCTGCTCCTGCTCACAGCGG - Intronic
1049424776 8:142533140-142533162 CAAGCAGCCCTTCCTCTCTGGGG - Intronic
1049443179 8:142618395-142618417 TCAGCAGCTCCTGCAGCCTGTGG - Intergenic
1049621370 8:143599721-143599743 TCAGTGGCCCCACCTCTCTGGGG - Exonic
1049659891 8:143815246-143815268 GCAGCAGCTCCTCCAGGCTGCGG + Exonic
1051599871 9:18862055-18862077 TCAGCAGCGGCTCCTTCCTGTGG + Intronic
1052226596 9:26096453-26096475 TCAGCAACTACTCCTCAGTGTGG + Intergenic
1053097529 9:35341537-35341559 TCAGGAGCTCCTAGTCTCAGAGG - Intronic
1053552671 9:39100699-39100721 CCAGGATCTCCTCCTCTCAGAGG + Intronic
1053816786 9:41920863-41920885 CCAGGATCTCCTCCTCTCAGAGG + Intronic
1054107046 9:61064545-61064567 CCAGGATCTCCTCCTCTCAGAGG + Intergenic
1054613811 9:67266580-67266602 CCAGGATCTCCTCCTCTCAGAGG - Intergenic
1054938052 9:70710284-70710306 TAGAGAGCTCCTCCTCTCTGAGG + Intronic
1054939743 9:70728277-70728299 TAGAGAGCTCCTCCTCTCTGAGG + Intronic
1055551635 9:77436974-77436996 TGAGCATCTCCTCCTCTGAGAGG - Intronic
1056269958 9:84937690-84937712 TCTGCTTCTCCTCCTCTCTATGG - Intronic
1056821964 9:89848820-89848842 TCAGGAGCTGCCCCTCACTGAGG - Intergenic
1056949947 9:91033952-91033974 TCAGCAGCGCCTCCTGTTGGTGG - Intergenic
1057436947 9:95049037-95049059 TCACAGGCTGCTCCTCTCTGTGG - Intronic
1058076866 9:100660324-100660346 TCAGCAGATACTCCACTGTGTGG - Intergenic
1058323124 9:103658747-103658769 TCAGCAGATCTTCCATTCTGGGG - Intergenic
1059372308 9:113852246-113852268 TCAGCAGCTCCATATCACTGGGG - Intergenic
1059760848 9:117336143-117336165 TCCCCAGCACCTCCTGTCTGAGG - Intronic
1060010709 9:120040806-120040828 TAGCCAGCTCCTCCTCTCAGGGG + Intergenic
1060064370 9:120490290-120490312 TCAGTTGTTTCTCCTCTCTGAGG + Intronic
1060978731 9:127780348-127780370 ACAGCAGCTCCCCCTCCATGGGG + Intergenic
1061189173 9:129071665-129071687 CCAGCATCATCTCCTCTCTGTGG - Exonic
1061297034 9:129682380-129682402 TCCTCAGCCCCTCCTCTCTTAGG - Intronic
1061370406 9:130194463-130194485 TCTGCAGCTCTGGCTCTCTGGGG + Intronic
1061503858 9:131019750-131019772 TAGGCAGCCCCTTCTCTCTGGGG - Intronic
1061730711 9:132611709-132611731 TCAGCAGCTCCTGGAATCTGAGG + Intronic
1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG + Intronic
1061842084 9:133364721-133364743 TCAGCAGCTCCCCCAGGCTGTGG + Intronic
1061955979 9:133961547-133961569 ACAGCTGCTTCACCTCTCTGGGG + Intronic
1062568836 9:137175236-137175258 CCAGCAGCTCCTCCTCCTTCTGG + Exonic
1186154415 X:6710667-6710689 TCAGCAGCTCCTGCACTATTTGG - Intergenic
1187259251 X:17669997-17670019 CCAGTAGATCCTGCTCTCTGTGG + Intronic
1187593675 X:20746580-20746602 GCAGGAGCTTCTCTTCTCTGTGG + Intergenic
1188584150 X:31752063-31752085 TCATCACCTCCTTCTCTCTTAGG + Intronic
1189017135 X:37295974-37295996 ACAGCAGCTCCTCCTATCACAGG - Intergenic
1190525528 X:51326036-51326058 TCAGAAGCTCCTCGTCTTAGAGG - Intergenic
1192630057 X:72770250-72770272 TCAGCCGCCCCTGCACTCTGTGG + Intergenic
1192651653 X:72950554-72950576 TCAGCCGCCCCTGCACTCTGTGG - Intergenic
1193667788 X:84344381-84344403 TCAGCAGGGCCTCCTCTTGGAGG + Exonic
1194182006 X:90722818-90722840 TCTGCTACTACTCCTCTCTGAGG - Intergenic
1196579348 X:117361310-117361332 ACAGCAGCTCCTCCTATCACAGG + Intergenic
1199778784 X:151039049-151039071 CCAGCAGATCCATCTCTCTGTGG + Intergenic
1200154595 X:153968818-153968840 GCAGCACCTTCTCCACTCTGTGG - Intronic
1200528633 Y:4304728-4304750 TCTGCTACTACTCCTCTCTGAGG - Intergenic
1201371626 Y:13270524-13270546 TAAGCAGCCCATCCTCTCTCAGG + Intronic
1202275913 Y:23119296-23119318 TCAGCAGCTCCCGCTCTTGGTGG - Intergenic
1202290115 Y:23301395-23301417 TCAGCAGCTCCCGCTCTTGGTGG + Intergenic
1202428907 Y:24753015-24753037 TCAGCAGCTCCCGCTCTTGGTGG - Intergenic
1202441884 Y:24917074-24917096 TCAGCAGCTCCCGCTCTTGGTGG + Intergenic