ID: 926801807

View in Genome Browser
Species Human (GRCh38)
Location 2:16665840-16665862
Sequence GGCCGCCGCAGCCTGCGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926801798_926801807 10 Left 926801798 2:16665807-16665829 CCGCTCCGCCGCCGCCGAGTACG 0: 1
1: 0
2: 0
3: 7
4: 79
Right 926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 134
926801799_926801807 5 Left 926801799 2:16665812-16665834 CCGCCGCCGCCGAGTACGCCTCT 0: 1
1: 0
2: 2
3: 5
4: 116
Right 926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 134
926801800_926801807 2 Left 926801800 2:16665815-16665837 CCGCCGCCGAGTACGCCTCTCCC 0: 1
1: 0
2: 0
3: 10
4: 68
Right 926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 134
926801795_926801807 23 Left 926801795 2:16665794-16665816 CCTGCTCTGCCGCCCGCTCCGCC 0: 1
1: 1
2: 4
3: 67
4: 642
Right 926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 134
926801797_926801807 11 Left 926801797 2:16665806-16665828 CCCGCTCCGCCGCCGCCGAGTAC 0: 1
1: 0
2: 3
3: 13
4: 203
Right 926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 134
926801801_926801807 -1 Left 926801801 2:16665818-16665840 CCGCCGAGTACGCCTCTCCCGCG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 134
926801793_926801807 27 Left 926801793 2:16665790-16665812 CCGCCCTGCTCTGCCGCCCGCTC 0: 1
1: 0
2: 10
3: 55
4: 571
Right 926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 134
926801796_926801807 14 Left 926801796 2:16665803-16665825 CCGCCCGCTCCGCCGCCGCCGAG 0: 1
1: 0
2: 7
3: 106
4: 818
Right 926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 134
926801794_926801807 24 Left 926801794 2:16665793-16665815 CCCTGCTCTGCCGCCCGCTCCGC 0: 1
1: 0
2: 0
3: 26
4: 273
Right 926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 134
926801803_926801807 -4 Left 926801803 2:16665821-16665843 CCGAGTACGCCTCTCCCGCGGCC 0: 1
1: 0
2: 0
3: 4
4: 56
Right 926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 134
926801792_926801807 30 Left 926801792 2:16665787-16665809 CCGCCGCCCTGCTCTGCCGCCCG 0: 1
1: 0
2: 4
3: 52
4: 457
Right 926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926801807 Original CRISPR GGCCGCCGCAGCCTGCGAGA CGG Intronic
900171998 1:1273813-1273835 CGCCGCCTCAGCCTCCAAGATGG + Exonic
900179742 1:1305892-1305914 GGTCGCCCCAGCCCGGGAGAGGG - Intronic
900572670 1:3366446-3366468 GGTCGGCACAGCCTGGGAGATGG - Intronic
901045448 1:6393223-6393245 GGCCGCTGCAGGCTGCGCGCGGG + Intronic
901190880 1:7409074-7409096 GACCACGGCAGCCTGAGAGAAGG + Intronic
903829123 1:26164416-26164438 CGCCGCCGCCGCCTGCGAGGGGG + Intergenic
904181297 1:28668699-28668721 GGCCGCCGCCGCCGGAGAGCTGG - Intergenic
906295293 1:44645734-44645756 GGCCGCCGCAGCAGGCGGGCAGG - Intronic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
907277793 1:53326739-53326761 TGCCGCCGGAGCCTGCGACCGGG - Intronic
910448995 1:87328536-87328558 CGCCGCCGCCGCCTCCGAGCCGG + Exonic
915549509 1:156624271-156624293 GGGCGGCGCGGCCTGGGAGAGGG - Intronic
915740206 1:158113479-158113501 GGCCGCGGCAGCCACCGAGCGGG - Intergenic
915902130 1:159854845-159854867 CGCCGCCGCCGCCTGCGAAGCGG - Exonic
924545500 1:245022909-245022931 GGTTGCCACAGGCTGCGAGAGGG - Intronic
1067416427 10:46106491-46106513 GGGCGCCGGCGCCTGCGGGAGGG - Intergenic
1067436558 10:46282969-46282991 GGGCGCCGGCGCCTGCGGGAGGG - Intergenic
1067693931 10:48522278-48522300 GGCCACAGCAGCCTGGGAGTAGG - Intronic
1069042964 10:63713590-63713612 GCCTGCCACAGCCTGGGAGAGGG + Intergenic
1073389152 10:103157827-103157849 GTCCGCCTCAGCCTCCCAGAGGG - Intronic
1076707211 10:132308347-132308369 GGCCCCCGGAGACCGCGAGAAGG - Intronic
1083652328 11:64210806-64210828 GGCAGCCACAGCCTGGAAGAGGG - Exonic
1083764061 11:64833739-64833761 GGCCGACGCAGCCTGCGCATGGG - Exonic
1085409736 11:76284027-76284049 GGCCGCAGCAGCCTGTGGGATGG - Intergenic
1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG + Exonic
1094041081 12:26122486-26122508 GGCGGCCGCGGGCTGCGGGAAGG + Exonic
1095958304 12:47819056-47819078 GGGCGCCGCAGGCTGTGTGAGGG - Intronic
1096121594 12:49092416-49092438 GGCCGCTCCAGCCTGGGAGCGGG + Intronic
1096482314 12:51951199-51951221 GGACGCGGCAGCCTGTGTGATGG - Intergenic
1101493960 12:105236161-105236183 GGCCGCCGCCGCCTGCCCGCCGG + Intronic
1101680184 12:106956386-106956408 GGCATCAGCAGCCTGGGAGAGGG + Intronic
1107481513 13:40789588-40789610 GGCCGCCCCAGCCGGCGACCCGG + Exonic
1107861564 13:44665861-44665883 AGCCACCGCACCCTGCCAGAAGG + Intergenic
1109687699 13:65843420-65843442 GGCTGCCCAAGCCTCCGAGAGGG - Intergenic
1117135419 14:52730397-52730419 CGCCGCCGCAGCCAGCCCGAGGG + Exonic
1119157612 14:72425422-72425444 AGCCACCGCAGCCGGCCAGAAGG + Intronic
1119539236 14:75428025-75428047 GCCCGCCACAGCCTGCGGGAGGG + Intronic
1122081352 14:99269976-99269998 GCCCGCCGCAGCCCGCGGGGCGG - Intronic
1127469895 15:59281519-59281541 GCCCGCCTCGGCCTCCGAGAGGG + Intronic
1129299227 15:74615877-74615899 TGCAGCCGGAGCCTGGGAGACGG + Exonic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1129933429 15:79431098-79431120 AGCCGCCACAGCCCCCGAGAGGG + Intergenic
1130408378 15:83623564-83623586 AGCAGGCGCAGCCTGTGAGATGG - Intergenic
1131827011 15:96330395-96330417 CGCCGCCGCCGCCGCCGAGAGGG - Intronic
1132459249 16:42262-42284 AGCCGCAGCAGGCTGTGAGAGGG + Intergenic
1132751733 16:1460777-1460799 GGCCGCTGCAGCTTGGGAGGGGG - Intronic
1132760194 16:1505293-1505315 GGCCCGCCCAGCCTGGGAGAAGG - Intronic
1134066047 16:11229067-11229089 GGCTGCTGCAGCATGCGTGAGGG - Intergenic
1135636256 16:24078225-24078247 AGCCGCTGCAGCGTGGGAGAGGG + Intronic
1136372450 16:29844855-29844877 GGCCGCCGCTTCCTGGGAGTTGG - Exonic
1140046319 16:71442319-71442341 GAACGCCGCAGCCTGGGGGAAGG - Intergenic
1140223270 16:73058763-73058785 GGCGGCCGCAGCCGGGGAGCCGG + Intronic
1141720216 16:85751505-85751527 GGCGGCTGCAGACGGCGAGATGG - Intergenic
1142165746 16:88586705-88586727 GGCCCCAGCTGGCTGCGAGAAGG - Intronic
1143136097 17:4713247-4713269 GCCCGCCTCAGCCTCCCAGAAGG - Intronic
1143200763 17:5111725-5111747 AGCCGCCGCTGCCTGCGGGACGG + Intronic
1143814979 17:9505693-9505715 GCCCGCCTCAGCCTCCCAGAGGG - Intronic
1144598194 17:16589197-16589219 TTCCGCCGCTCCCTGCGAGAGGG + Intergenic
1147016392 17:37495189-37495211 GGCAGCCTCAGCCTGGGCGAGGG + Intronic
1147718278 17:42522359-42522381 GGCCAGCCCAGCCTGGGAGAGGG - Exonic
1148550972 17:48550678-48550700 GGGCGCCGCAGCCTTTGAGAGGG + Exonic
1150326689 17:64263332-64263354 GGCCGCCGCCGCCAACCAGAGGG + Intergenic
1151202314 17:72477678-72477700 GGCAGCCGAGGCCTGGGAGAAGG - Intergenic
1152448398 17:80360433-80360455 GGCAGCAGGAGCCTGTGAGATGG + Intronic
1152668638 17:81587558-81587580 GCCCGCCTCAGCCTCCGAAAGGG + Intronic
1152711337 17:81871646-81871668 GGCCGCCGCAGGCCTCGAGTGGG - Intergenic
1152777591 17:82212590-82212612 CCCCGCCGCAGCCTCCGCGAGGG + Intronic
1153688205 18:7567241-7567263 CGCCGCCGCGGCCCGCTAGAGGG - Exonic
1154303899 18:13217470-13217492 GGTCGGCGCAGCCTGTGAGCCGG + Intergenic
1155133950 18:22968314-22968336 TGTCGCCGCAGCCTCCCAGAGGG + Intronic
1155519767 18:26656688-26656710 CGCCGAGGCTGCCTGCGAGAAGG + Intronic
1160122988 18:76147113-76147135 GGCCTCTGCAGCCTGCCAGCAGG + Intergenic
1161051031 19:2164150-2164172 GGCCGCCGCACCATGCTAGGCGG - Exonic
1161400931 19:4066004-4066026 GCCCGCCGCGGCCTGCGGGTAGG - Intronic
1162718704 19:12649152-12649174 GGGGGCAGCAGCCTGAGAGATGG - Exonic
1164802287 19:31087620-31087642 GGCAGCAGCAGCCTGTGAGCTGG + Intergenic
1168706297 19:58472129-58472151 GACCTCCGCTGGCTGCGAGACGG - Exonic
925394463 2:3522816-3522838 GGCTGCCGCAGCCTGGGGGTGGG - Intergenic
926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG + Intronic
930008429 2:46915882-46915904 GCCCGCCGCCGCCAGCGGGAGGG - Intronic
931681264 2:64751393-64751415 GGCTTCCGCAGCCGGCCAGAGGG + Intergenic
932314109 2:70768256-70768278 GGCCGGCGCGGCCTGCTGGAGGG - Intergenic
932599189 2:73112453-73112475 CTCCGCCGCCGCCTGCGAGCTGG - Exonic
933248572 2:80003101-80003123 AGCAGCAGCAGCCTGTGAGATGG + Intronic
935122854 2:100197681-100197703 GGCAGCAGCAGCCTGGGGGAGGG + Intergenic
938058841 2:128236599-128236621 GGCAGCCGCAGCCAGGGAGATGG + Intergenic
939635002 2:144571348-144571370 GGCTTCTGCAGCCTGGGAGAAGG - Intergenic
941819207 2:169827795-169827817 AGCCGCCGCCGCCCGCCAGAAGG - Exonic
942057694 2:172199847-172199869 GCCCGCCTCAGCCTCCCAGACGG + Intergenic
947992384 2:234497404-234497426 GGGCGACGCAGCCTGCCTGAGGG + Intergenic
948257135 2:236576681-236576703 GGCCGCCCCAGCCTGCGTGCAGG - Intronic
948917160 2:241040166-241040188 CACCGGAGCAGCCTGCGAGATGG + Exonic
1172083252 20:32358753-32358775 TGCCGCCGCCGCCGGGGAGAAGG + Exonic
1176385943 21:6138593-6138615 GGGTGCCGGAGCCGGCGAGAGGG + Intergenic
1179737530 21:43399659-43399681 GGGTGCCGGAGCCGGCGAGAGGG - Intergenic
1180092866 21:45541917-45541939 TTCCGCCGCAGCCTGCGAATGGG - Intronic
1180187136 21:46145567-46145589 CAGCGCCGCACCCTGCGAGAGGG + Exonic
1181017652 22:20080424-20080446 GGGCGCCGCGGCCTGCGCGAGGG + Intronic
1182332544 22:29561295-29561317 GGCCGCTGCAGCTTGGGAGGTGG - Intronic
1182486320 22:30641203-30641225 GGCAGCCCCAGCCTGCAGGAGGG + Intronic
950359613 3:12441128-12441150 GGCCGCCTGAGCCTGCCAGATGG + Intergenic
955753203 3:62203415-62203437 GGCCGCCTCAGCCAGCAAGCAGG + Exonic
968473537 4:792400-792422 GGCCGGCCCCGCCTGCGGGAAGG - Intronic
968520203 4:1031656-1031678 GGCTCCTGCAGCCTGAGAGATGG + Intergenic
973144304 4:46805180-46805202 GGCTCCCTCAGCCTGCGAGGAGG - Intronic
973956489 4:56068327-56068349 GGCCGCTGCAGCCTGAGGGGAGG + Intergenic
975779059 4:77819925-77819947 GGCCGCGGCCGCCGGCGCGAAGG + Intergenic
978749493 4:112231566-112231588 AGCCGCCTCTGCCTGCGAGACGG - Intergenic
988782440 5:34534622-34534644 GGCCTCCTCCTCCTGCGAGAAGG - Intergenic
989133695 5:38132142-38132164 GGCCACCCCCGCCTGCGTGACGG + Intergenic
991061073 5:62376664-62376686 GCCCGCCTCAGCCTCCCAGAGGG + Intronic
992106329 5:73451594-73451616 GGCCCCCGCAGCCGGTGGGAGGG - Intergenic
995354810 5:111224883-111224905 GGAAGTGGCAGCCTGCGAGAAGG - Intronic
999725372 5:154432569-154432591 AGCCGCCGCACCCTGCTATATGG - Intergenic
1002616335 5:180458785-180458807 GGGCGCTGCAGCCAGAGAGATGG - Intergenic
1002771317 6:292611-292633 GGCAGCCGACGCCGGCGAGACGG - Intronic
1002896624 6:1383589-1383611 CGCCGCCGCAGCCCGCCCGAAGG + Intergenic
1003887496 6:10534555-10534577 GTCAGCCGCAGCCTGAGAGGTGG - Intronic
1007446622 6:41911394-41911416 GCCCGCCTCAGCCTCCGAAAGGG + Intronic
1007773475 6:44209626-44209648 AGCCACCGCAGCCTGCCAAAAGG - Intergenic
1013836598 6:114342411-114342433 CGCCGCCGCCGCCTGCGTGTGGG - Exonic
1014230132 6:118894109-118894131 GGCCTCGGCAGCCAGCAAGATGG - Intronic
1015364844 6:132385856-132385878 GCCCGCCTCAGCCTCCCAGAGGG - Intronic
1015786255 6:136923191-136923213 GGCCGCCTGAGCCTGGGAGCTGG + Intronic
1019927561 7:4203301-4203323 GGCCTCTGCGGCCTGGGAGAGGG - Intronic
1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG + Intronic
1022520939 7:31006537-31006559 TGCCCCCACAGCCTGTGAGAGGG - Intergenic
1029671167 7:102032172-102032194 GCCCGCCTCAGCCTCCCAGAGGG + Intronic
1034298534 7:149995098-149995120 GCCCGCCTCAGCCTCCCAGAGGG + Intergenic
1034807481 7:154101680-154101702 GCCCGCCTCAGCCTCCCAGAGGG - Intronic
1035585393 8:768948-768970 GGCGTCCGCAGCCTGTGTGAGGG + Intergenic
1038451608 8:27643009-27643031 GGCAGCACCAGCCTGCGAGCAGG + Intronic
1048364874 8:133729952-133729974 GGCCTGCCCAGCCTGCAAGAAGG - Intergenic
1049671475 8:143872013-143872035 GGCAGCCGGAGCCTGCGTGCTGG + Exonic
1049693718 8:143973627-143973649 GGCCGCCGCGGCCGGGCAGAGGG + Intronic
1056495132 9:87148640-87148662 CGGCGCGGCAGCCAGCGAGAGGG + Exonic
1061574445 9:131497250-131497272 GGCCTGCGCAGCCTCCGGGAGGG + Exonic
1062580843 9:137228611-137228633 GGCTGCAGCATCCTGCCAGAGGG - Exonic
1203774073 EBV:63095-63117 GGCCGCCGCACTCAGCGAGGAGG - Intergenic
1186574431 X:10750384-10750406 GCCTGCCTCAGCCTCCGAGAGGG - Intronic
1188005004 X:25011162-25011184 GGCCGCCGAAGCCTGGGACCTGG + Intronic
1190342572 X:49309085-49309107 GGCCACAGCAGGCTGTGAGAGGG + Intronic
1192214605 X:69150021-69150043 GGCCGCCGAGGCCTGGGAGCCGG + Intergenic
1192224974 X:69221742-69221764 GGCCGCCGAGGCCTGGGAGCCGG - Intergenic
1200240433 X:154490416-154490438 GGCCCCCCCAGACTCCGAGACGG - Exonic
1201357438 Y:13112361-13112383 GGCTGCAGCAGGCTGTGAGAGGG + Intergenic