ID: 926806912

View in Genome Browser
Species Human (GRCh38)
Location 2:16719563-16719585
Sequence TGTTAAGCACAGTCTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926806906_926806912 28 Left 926806906 2:16719512-16719534 CCATCTTGTGGGTTCTCGTAAAT No data
Right 926806912 2:16719563-16719585 TGTTAAGCACAGTCTGAGCTGGG No data
926806910_926806912 -5 Left 926806910 2:16719545-16719567 CCACTGGGCATCAGATAATGTTA No data
Right 926806912 2:16719563-16719585 TGTTAAGCACAGTCTGAGCTGGG No data
926806909_926806912 1 Left 926806909 2:16719539-16719561 CCTATGCCACTGGGCATCAGATA No data
Right 926806912 2:16719563-16719585 TGTTAAGCACAGTCTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926806912 Original CRISPR TGTTAAGCACAGTCTGAGCT GGG Intergenic
No off target data available for this crispr