ID: 926808481

View in Genome Browser
Species Human (GRCh38)
Location 2:16735198-16735220
Sequence GCTCACTTGCCGGTTTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926808481_926808484 -4 Left 926808481 2:16735198-16735220 CCTATGGAAACCGGCAAGTGAGC No data
Right 926808484 2:16735217-16735239 GAGCCTTCAAAGGAGCTCTGTGG No data
926808481_926808488 15 Left 926808481 2:16735198-16735220 CCTATGGAAACCGGCAAGTGAGC No data
Right 926808488 2:16735236-16735258 GTGGGAGCACAGTGCTCTCTGGG No data
926808481_926808489 28 Left 926808481 2:16735198-16735220 CCTATGGAAACCGGCAAGTGAGC No data
Right 926808489 2:16735249-16735271 GCTCTCTGGGACCCCAGAGCAGG No data
926808481_926808487 14 Left 926808481 2:16735198-16735220 CCTATGGAAACCGGCAAGTGAGC No data
Right 926808487 2:16735235-16735257 TGTGGGAGCACAGTGCTCTCTGG No data
926808481_926808490 29 Left 926808481 2:16735198-16735220 CCTATGGAAACCGGCAAGTGAGC No data
Right 926808490 2:16735250-16735272 CTCTCTGGGACCCCAGAGCAGGG No data
926808481_926808485 -3 Left 926808481 2:16735198-16735220 CCTATGGAAACCGGCAAGTGAGC No data
Right 926808485 2:16735218-16735240 AGCCTTCAAAGGAGCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926808481 Original CRISPR GCTCACTTGCCGGTTTCCAT AGG (reversed) Intergenic
No off target data available for this crispr