ID: 926808758

View in Genome Browser
Species Human (GRCh38)
Location 2:16737857-16737879
Sequence CTTGATGTATAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926808758_926808762 22 Left 926808758 2:16737857-16737879 CCTTCCTCCATCTATACATCAAG No data
Right 926808762 2:16737902-16737924 CACTATGTGCCCACTTGTGTTGG No data
926808758_926808763 23 Left 926808758 2:16737857-16737879 CCTTCCTCCATCTATACATCAAG No data
Right 926808763 2:16737903-16737925 ACTATGTGCCCACTTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926808758 Original CRISPR CTTGATGTATAGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr