ID: 926810399

View in Genome Browser
Species Human (GRCh38)
Location 2:16750706-16750728
Sequence TAGTATCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926810394_926810399 15 Left 926810394 2:16750668-16750690 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG No data
926810393_926810399 21 Left 926810393 2:16750662-16750684 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG No data
926810395_926810399 14 Left 926810395 2:16750669-16750691 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG No data
926810392_926810399 24 Left 926810392 2:16750659-16750681 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG No data
926810397_926810399 3 Left 926810397 2:16750680-16750702 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926810399 Original CRISPR TAGTATCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr